protocol for a facile multiplex pcr for multi antimicrobial resistance and gonococcus detection

Báo cáo nghiên cứu khoa học " IMPROVING CAPABILITY FOR ASSESSING SOIL CONSTRAINTS USING THE SCAMP DECISION SUPPORT SYSTEM " docx

Ngày tải lên : 22/06/2014, 12:20

... custard apples and grapes are grown In contrast, so easy to make a soil pit on a sandy soil grown to onion and garlic from Phan Rang Thap Cham, Ninh Thuan Participants from each group examined ... Practice applied to maize at Gia Lai (Ferralsol) and Tay Ninh (Acrisol) 205 Collaboration for Agriculture and Rural Development (CARD) Program Documentation of Soil-specific Management Guidelines for ... at both sites SCAMP treatments (balanced fertilisation using fertiliser ‘straights’ such as FMP and urea, and the application of locally available plant amendments) had higher benefit cost ratios...

4
318
0

The factors affecting user?s satisfaction in using the Customer Management Information System at Vietnam?s Northern Power Corporation (NPC)

Ngày tải lên : 20/07/2015, 21:12

... Data Analysis Descriptive Analysis Factor Analysis ANOVA Test Regression Analysis References The DeLone and McLean Moel of Information Systems Success: A Ten – Year Update, William H.Delone and ... Companies, and power sub-companies are using a Customer Management Information System (CMIS) for power production and sale management CMIS is responsible for overall management of information about ... H.Delone and Ephraim R McLean.15, 16 The DeLone and McLean Moel of Information Systems Success: A Ten – Year Update William H.Delone and Ephraim R Mclean, journal of Management Information Systems/Sping...

21
877
0

Báo cáo khoa học: "Optimization of in situ hybridization assay using nonradioactive DNA probes for the detection of canine erpesvirus (CHV) in paraffin-embedded sections" pdf

Ngày tải lên : 07/08/2014, 17:22

... Elsevier, Amsterdam, 1987 Kim O Development of in situ nest PCR and comparison of five molecular biological diagnostic methods for the detection of intracellular viral DNAs in paraffin sections ... the changes of enzyme-concentrations, the time of hybridization and hybridization probes, were compared in formalin fixed and paraffin embedded CHV-infected cells The optimum result was obtained ... solution was described previously [3] For detection of hybridization, sections were incubated with anti-digoxigenin conjugated with alkaline phosphatase (Roche) for digoxigenin-labeled probe and streptavidin...

3
301
0

Learning DebianGNU Linux-Chapter 6: Using the X Window System

Ngày tải lên : 07/11/2013, 10:15

... such as Kfract, a fractal generator, and Kview, an image viewer  Multimedia applications such as Kmix, a sound mixer, and Kmedia, a media player  Network applications such as Kmail, a mail client, ... provides a file manager, a help system, a configuration utility and a variety of accessories and applications, including:  Games such as Kmines, Kpoker, and Ktetris  Graphical applications such as ... display the pager The panel can also contain applets, programs represented as panel icons Applets are typically small programs that display information or take action when clicked For example, a...

34
298
0

Tài liệu Lab 5.1.3 Using the Boot System Command pptx

Ngày tải lên : 18/01/2014, 04:20

... with information about the flash memory and what IOS image file(s) are stored there b Document the following information: How much flash memory is available and used? _ What is ... for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config ... router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for...

5
395
0

Tài liệu Lab 5.1.3 Using the Boot System Command doc

Ngày tải lên : 18/01/2014, 04:20

... with information about the flash memory and what IOS image file(s) are stored there b Document the following information c How much flash memory is available and used? _ d What is ... for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for...

5
351
0

Tài liệu Network Application Security Using The Domain Name System pptx

Ngày tải lên : 14/02/2014, 08:20

... vanlia a ga namnuppslagningstj¨ nsten, Dom¨ nnamnssystemet (DNS), kan anv¨ ndas f¨ r att a a a o ˚ l¨ sa det problemet Vi visar hur DNS kan anv¨ ndas f¨ r att astadkomma s¨ ker epost o a o a ... of a secure mail application and of a certiﬁcate publishing application In chapter we compare LDAP and DNS for certiﬁcate locating and retrieval purposes In chapter we discuss privacy threats ... such tasks as preparing and submitting messages for its user, and receiving and preprocessing received messages for its user A User Agent may be a stand alone software application (sometimes called...

109
762
0

Báo cáo khoa học: "Question Answering System in the Web using the Web" doc

Ngày tải lên : 08/03/2014, 21:20

... recognition/classification in the ngrams and n-gram filtering Figure Named entity recognition/classification and filtering in the n-grams The final answers of the system are the best scored candidate answers ... In: Gonçalves, A & Correia, C.N (eds.): Actas XVII Encontro da Associação Portuguesa de Linguística (APL 2001) (Lisboa, 2-4 Outubro 2001) APL Lisboa, pp 485-495 Alessandro Vallin et al 2005 “Overview ... techniques used, Esfinge participated in the QA task at CLEF in 2004 and 2005 (Vallin et al, 2005) In this task the participants receive 200 questions prepared by the organization and a document collection...

4
454
0

CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx

Ngày tải lên : 29/03/2014, 14:20

... (anthropogenic: GEIA/EDGAR; NEC-II + natural international ship traffic as All/15 for the year 2020) Appendix A Figure A1 A2 A3 A4 A5 A6 A6 A8 A9 A1 0 A1 1 -A1 3 A1 4 A1 5 A1 6 A1 7 A1 8 A1 9 A2 0 -A2 2 A2 3 ... constitute a large fraction of the particle mass Before the pollutants reach humans and can be respired the particles have had time to mix and react and neither primary nor secondary particles are breathed ... was then applied to estimate human health and environmental impacts, costs and potential air-quality targets They estimated that the annual health impacts from air pollution due to PM and O3 alone...

98
634
0

Báo cáo hóa học: " Neurorehabilitation using the virtual reality based Rehabilitation Gaming System: methodology, design, psychometrics, usability and validation" pot

Ngày tải lên : 19/06/2014, 08:20

... c) Performance as a function of Size and Range; d) Performance as a function of Interval and Speed; e) Performance as a function of Range and Speed; f) Performance as a function of Range and Interval ... parameters of the training scenario and the user’s performance through a four way analysis of variance (ANOVA) with the game score as the dependent variable and Speed, Interval, Range and Size as ... paretic and the nonparetic arm in patients, and between nondominant and dominant arms for controls The same analysis was done for the final score A ratio of 100% would represent a perfect matching...

14
498
0

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

Ngày tải lên : 15/05/2015, 00:37

... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified ... Statistical analysis Basic and batch-wise calculations for behavioural analysis and Ct method were performed using Microsoft Excel 2010 tables All statistical analyses including regressions and ... scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent...

58
262
0

Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro

Ngày tải lên : 01/10/2015, 17:27

... forward (5’GGGGACAAGTTTGTACAAAAAAGCAGGCTgcgaattcatcgatagatctgat-3) and reverse (5’GGGGACCACTTTGTACAAGAAAGCTGGGTCctacttgtcatcgtcatccttg-3’) primers to amplify the region covering the ORF of p3xFLAG-CMV14 ... 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for qPCR data was analyzed using the ABI 7500 software v2.0.6 The amount of DNA quantified for each sample is calculated as a percentage ... blotting analysis was performed using Gene Images AlkPhos Direct labelling and detection system (GE Heathcare) according to manufacturer’s protocol, and DNA was detected by an AP-labelled substrate...

125
395
0

AN1024 PKE system design using the PIC16F639

Ngày tải lên : 11/01/2016, 16:36

... ISO/TS-16949:2002 certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona, Gresham, Oregon and Mountain View, California The Company’s quality system ... the carrier frequency of the base station The loop antenna is made of a coil (inductor) and capacitors that are forming a parallel LC resonant circuit The voltage across the antenna is also maximized ... D2, and capacitor C5 are for the Battery Back-up mode Diodes D2, D3 and D7 and capacitor C5 are for Batteryless mode A larger C5 value is needed for stable Batteryless mode operation Capacitor C5...

26
408
0

Expert Service Oriented Architecture in C Sharp Using the Web Services Enhancements

Ngày tải lên : 20/08/2012, 13:59

... reliability and scalability because they can be stored, and the services that process the messages can append additional information, which provides for a clear and unambiguous chain of custody across ... Hiroshi Maruyama (IBM), Anthony Nadalin (IBM, editor), Nataraj Nagaratnam (IBM), Paul Patrick (BEA), Claus von Riegen (SAP), and John Shewchuk (Microsoft) Whitepaper (December 2003) Located at MSDN ... well-defined interfaces that process and deliver XML messages A servicebased approach makes sense for building solutions that cross organizational, departmental, and corporate domain boundaries A business...

336
841
2

The UNIX Time Sharing System

Ngày tải lên : 12/09/2012, 15:05

... this way: file and device I/O are as similar as possible; file and device names have the same syntax and meaning, so that a program expecting a file name as a parameter can be passed a device name; ... name /alpha/beta/gamma causes the system to search the root for directory alpha, then to search alpha for beta, finally to find gamma in beta gamma may be an ordinary file, a directory, or a ... command to the input of another A sequence of commands separated by vertical bars causes the shell to execute all the commands simultaneously and to arrange that the standard output of each command...

15
942
0

Shop Manual & ETM BCM KIA Cerato 2010 - Auto Lighting Control System

Ngày tải lên : 22/10/2012, 15:55

... supply and raises up a failure as soon as the supply’s voltage is out of range Then this failure occurs and as long as this is present, the head lamp must be turned on without taking care about ... Inspection In the state of IGN1 ON, when multi function switch module detects auto light switch on, tail lamp relay output and head lamp low relay output are controlled according to auto light sensor's ... Auto light sensor Head lamps Lighting switch (Auto) 2010 > G 1.6 DOHC > Body Electrical System Circuit Diagram Tail lamps Body control module (BCM) Language 2010 > G 1.6 DOHC > Body Electrical...

5
465
2

Báo cáo y học: "Medical emergency teams and rapid response triggers - the ongoing quest for the ‘perfect’ patient safety system"

Ngày tải lên : 25/10/2012, 10:02

1
582
0

USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM

Ngày tải lên : 23/04/2013, 10:29

... start drawing the hierarchy model Guidelines for formulation of a hierarchy are available in the literature and numerous proven ready-made hierarchies are also available Saaty and Forman [55] have ... financial means for additional research Basic research Outputs Standard and rules Recognition and rewards Knowledge and learning Cost-effective products and services New application Organizational ... authority and loyalty A similar analogy can be drawn for the differences that exist at large between the scientific or academic world and the world of organizations and management as shown in Table...

73
495
2

Thể dục Tiết 30

Ngày tải lên : 14/06/2013, 01:26

... đ a hình tự nhiên - Chạy liên tục cự li 400 1500m ( tuỳ theo thứ tiết ) thở chạy 3.Củng cố: - Kĩ thuật chắn bóng, đập C Phần kết thúc - Thả lỏng dũ chân tay kết hợp thở sâu - Nhận xét học - Ra ... hìng IV Rút kinh nghiệm - GV gọi 2HS HS yếu lên thực Lớp quan sát ,so sánh - Gv nhận xét, rút kinh nghiệm chung - Học sinh tự thả lỏng sau lần thực động tác - Gv nhận xét u, khuyết điểm - Dặn học ... C Phần kết thúc - Thả lỏng dũ chân tay kết hợp thở sâu - Nhận xét học - Ra tập nhà + Chống đẩy nam 30l x 2- tổ nữ 25l x - tổ - GVnêu tập, học sinh thực động tác - GV nhận xét cho điểm - GV tổ...

2
366
0

You can draw in 30 days (bạn có thể vẽ trong 30 ngày!)

Ngày tải lên : 22/08/2013, 08:52

... trụ thoi NASA, tàu thám hiểm h a nhiều sinh viên khác tham gia vào dự án lớn Shrek, Madagascar, Flushed Away, the Incredibles, Happy Feet A bug's Life Nhưng bí mật - học học mà vẽ vẽ, không cần ... học, ngày, đ a điểm Sau vẽ hai điểm cách đoạn 2 Dùng bàn tay không cầm bút chì bạn, để đầu ngón tay hai điểm hình, sau dùng bút vẽ hai điểm cách đầu ngón tay bạn đoạn hình Cố gắng giữ hai điểm vẽ ... xác định khối cầu xa Nó xuất dưới, sau vật thể gần Ví dụ, đan hai tay bạn vào trước mặt bàn Quan sát kĩ bạn thấy khoảng bóng tối nhỏ hình thành đường bao ngón tay khớp ngón tay Trong nháp bạn,...

330
5.6K
41