proteinases cystatin c enzyme expression a novel mechanism of dhea on cartilage in different stages of oa
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx
... GAGCTCAGATACGTTGAC-3¢); and b-actin (forward: 5¢-CGTGGGCCGCCCTAGGCACCA-3¢,reverse: 5¢-TTG GCCTTAGGGTTCAGGGGGG-3¢ PCR cycling conditions were: de-naturation at 94 C for 30 s, annealing at 52 C for ... total RNA using 100 ng random hexamer (Pharmacia, Uppsala, Sweden) The PCR primer sequences used were as follows FasL (forward: 5¢-ATGTTTCAGC TCTTCCACCTACAGAAGGA-3¢, reverse: 5¢-CAGAGA GAGCTCAGATACGTTGAC-3¢); ... all-trans-RA concentrations as low as 0.1 lM, and NFAT binding was abolished in the presence of 1.0 lM all-trans-RA In contrast, SP-1 binding was similar at all concentrations of all-trans-RA...
- 9
- 481
- 0
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc
... subunit interactions necessary for efficient catalysis Results At saturating concentrations of substrates in either the forward oxidative deamination reaction or reverse reductive amination reaction, ... of zinc caused a significant change in the threedimensional fluorescence spectrum of the protein suggesting that a conformational change had occurred The differential scanning calorimetry and limited ... involved in GTP inhibition [30,31] In contrast, Eu3+ binds to the internal base of the antenna and abrogates the inhibition by zinc without affecting zinc binding This is clearly a classic case of allostery...
- 12
- 544
- 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively cells ... antisense hRhoA sense hRhoA antisense GAPDH-F GAPDH-R Sequence (5¢- to 3¢) GGGATCAGAGTTCATAGTGAAAAGAG GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTC GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA ... TGFb-induced actin reorganization flattening and scattering, supported by changes in the organization of the actin cytoskeleton (Fig 5D) In contrast to control adenovirus (LacZ), ectopic expression...
- 14
- 420
- 0
Báo cáo y học: "Platelet-derived exosomes induce endothelial cell apoptosis through peroxynitrite generation: experimental evidence for a novel mechanism of septic vascular dysfunction" pot
... [4,8], and with annexin V-FITC conjugate in a calcium-containing binding buffer Binding of annexin V indicates the exposure of phosphatidylserine on the particle surface In contrast to signaling ... dysfunction [44], impairing vasorelaxation and altering cardiac contractility in isolated vessel and heart models (L .C. P Azevedo, unpublished data) Although the mechanisms of vascular damage are ... diagnosis of septic shock, as defined in accordance with the criteria of the American College of Chest Physicians and the Society of Critical Care Medicine [20] Patients were not on any antiplatelet...
- 12
- 290
- 0
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... 5′-TGA-CTC-TAA-GTG-GCATTC-AAG-G (sense) and 5′-GAT-TCA-GAC-ATC-TCTTCT-CAC-CC (antisense) for IP-10 [24], and 5′-GTG-GGG-CGC-CCC-AGG-CAC-CA (sense) and 5′-CTC-CTT-AAT-GTC-ACG-CAC-GAT-TTC (antisense) ... R76 Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA, USA) and expressed as mean ± SEM Groups of data were compared ... study, RA SF contained greater amounts of IP-10 as compared with OA SF Immunolocalization analysis indicated that IP-10 was associated mainly with infiltrating macrophage-like cells, and fibroblast-like...
- 8
- 446
- 0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps
... Wardale RJ, Capper SJ, Mason DJ, Duance VC: Up-regulation of matrix metalloproteinase expression and activation following cyclical compressive loading of articular cartilage in vitro Arch Biochem ... inhibition of protein synthesis and increased apoptosis, which may also affect cartilage integrity Increased expression and activation of MMPs, in the absence of a corresponding increase in their inhibitors, ... proteoglycan catabolism involving PKR that may be important in cartilage degradation Others have shown that ceramide stimulates aggrecanase-mediated degradation of proteoglycans in articular cartilage, ...
- 10
- 379
- 0
Báo cáo y học: "A Melanesian -thalassemia mutation suggests a novel mechanism for regulating gene expression" potx
... histone acetylation is increased and the chromatin becomes more flexible as a consequence, resulting in a change in loop size This change means that the enhancer now preferentially interacts ... decreased in the mutant allele, as expected from the phenotype The A G transition created a known binding site (TAATAA→TGATAA) for the erythroid-specific transacting factor GATA1 This altered binding ... production of the ␣-globin and -globin chains that make up hemoglobin is unbalanced This Melanesian form of HbH disease is the first natural example of a mutation that causes the function of an...
- 3
- 137
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... 5¢-CCTCTACACCCCCATT TACTTC-3¢; TRHR-6, 5¢-CACGGTTCTGTATGGAC TCATAG-3¢ (Fig 1B) 500 ng of brain poly (A) + RNA were reverse transcribed into cDNA using an adapter primer (5¢-GGCCACGCGTCGACTAGTACTTTTTTTT ... (5¢-GAGACCATACAGAAC -C- 3¢); second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA ... oligonucleotide, A5 NV (300 ng, 5¢-CTGCATCTATCTA ATGCTCCT-CTCGCTACCTGCTCACTCTGCGTGA CATC-NH2-3¢, Genset, Paris, France), in 11 lL containing T4 RNA ligase (50 U, Biolabs), 1X T4 RNA ligase buffer, and 23%...
- 11
- 506
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... (forward), 5¢-caccattactctgtctcctc-3¢ (reverse); KS 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaac gcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctggga agcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ ... clustered on chromosome 16 Bars indicate exons (forward), 5¢-ggttaaacaccacagaggcc-3¢ (reverse); OCAM 5¢-gagaagtggtgtcccctcaa-3¢ (forward), 5¢-cctccatcatcttgctt ggt-3¢ (reverse); NCAM 5¢-cttcctgtgtcaagtggcag-3¢ ... prepared by RT-PCR using a pair of primers: EcoRI-rO-MACS-U (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢) for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc...
- 10
- 393
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... sapE–F 2590 F sapE–R 2590 R mopB–F 3103 F mopB–R 3103 R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC ... (CxxCH), in addition to the amino acids coordinating the calcium ion present in the interface domain of the solved CCPs are positionally conserved in MCA2590 It is also evident that the MCA2590 and ... of (A) distinct bands, all of which could be traced to corresponding bands on a parallel CBB-stained polyacrylamide gel (Fig 8) Most importantly, a distinct band of molecular mass corresponding...
- 12
- 392
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... to achieve 50% relaxation of the scDNA Synthetic 20 mer oligonucleotides (ODNs), the speci c 5¢-AGACATGCCTAGACATGCCT-3¢ (CON) and nonspeci c 5¢-GCATCATAGCGCATCATAGC-3¢ (NODN), including their complementary ... conditions (in its ÔinducedÕ, ÔactivatedÕ state, being able to bind DNA mainly sequence-specifically) or taking part directly in control of DNA replication, recombination [11,12] or repair (in a transcription-independent ... correspond to free monomeric scDNA and open circular DNA, respectively Species migrating between sc and ocDNA are p53–scDNA or mAb–p53–scDNA complexes (B ,C) Effects of increasing amounts of the mAbs...
- 12
- 265
- 0
Báo cáo y học: "Serum cystatin C concentration as a marker of acute renal dysfunction in critically ill patients" doc
... it can increase as GFR decreases All of these factors explain why serum creatinine concentration may not be a good parameter for accurate determination of GFR, especially at lower rates [1] Cystatin ... Nonparametric receiver operating characteristic plots of sensitivity and specificity of serum creatinine and cystatin C Area under the curve (95% confidence interval): creatinine 0.694 (54.1–84.6) and cystatin ... cystatin C and serum creatinine for identifying renal dysfunction was evaluated using receiver operating characteristic curve analysis, and the data are expressed as area under the curve (AUC;...
- 5
- 224
- 0
Báo cáo y học: " In-Silico docking of HIV-1 integrase inhibitors reveals a novel drug type acting on an enzyme/DNA reaction intermediate" pdf
... (involved in the gene-silencing pathway) [1,6] These proteins display similar 3D folding of the catalytic domain and a conserved catalytic triad of metal-coordinating carboxylates IN catalyses at least ... Mapping 3of the nucleic acid-binding sites within the HIV-1 integrase (IN) catalytic site Mapping of the nucleic acid-binding sites within the HIV-1 integrase (IN) catalytic site Panel A: Structural ... green; DNA: in violet) The catalytic triads of IN and Tn5 transposase are shown in red and black, respectively Panel B: transposition of Tn5 donor DNA (carbon backbone in cyan) to a crystal structure...
- 15
- 343
- 0
Báo cáo y học: "Creation and disruption of protein features by alternative splicing a novel mechanism to modulate function" docx
... polypyrimidine tract binding protein by alternative splicing leading to nonsense-mediated decay Mol Cell 2004, 13:91-100 Garcia-Blanco MA, Baraniak AP, Lasda EL: Alternative splicing in disease and ... important processes For example, phosphorylation of splicing factors can influence splicing decisions [18] and glycosylation is associated with a modulation of proteolytic resistance and ligand binding ... them on the sequence level For example, splicing at an alternative donor site of the protein kinase C delta leads to an insert of 26 amino acids into a caspase-3 cleavage site and to an isoform...
- 8
- 252
- 0
Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death
... phase of re-perfusion Increased Na+ that gets accumulated in the cell activates the Na+/Ca++ exchanger Na+ then leaks out of the cell in exchange for Ca++ ions Increased concentration of Ca++ ... transport of acid/base equivalents across cell membrane via specialized transporters In fact many cells face a constant acid load due to metabolic acid production and leakage of H+ ions from intracellular ... (CD95/Fas)-induced apoptosis is mediated by early caspase recruitment and activation, which can induce a drop in cytosolic pH (pHc) and facilitate the activation of downstream executioner caspases,...
- 155
- 399
- 0
Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients
... serum concentration of digoxin in the steady-state was examined serum levels of Cys -C and Cr Correlations between continuous variables were calculated using Pearson’s correlation coefficients in ... et al Cystatin C concentration as a risk factor for heart failure in older adults Ann Intern Med 2005; 142(7):497–505 Mooradian AD Digitalis An update of clinical pharmacokinetics, therapeutic ... marker of creatinine or digoxin clearance than serum creatinine Br J Clin Pharmacol 2002; 53(4):398–402 26 Hallberg P, Melhus H, Hansson LO, Larsson A Cystatin C vs creatinine as markers of renal...
- 5
- 523
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... sequencing, and the recombinant virus was packaged by infecting the PacI linearized recombinant viral DNA into human embryonic kidney (HEK)-293 cells (Clontech, CA) The resulting recombinant virus ... was assessed by quantitative ELISA assays; in B, Vgf content decreased as a function of progression of muscle weakness assessed by manual muscle testing revealing an increased number of affected ... excitotoxic injury Thus a mechanism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against spinal cord motorneuron excitotoxic injury...
- 8
- 499
- 0
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf
... hypoxic inhibition of cartilage and chondrocyte degeneration Results Macroscopic and radiographic examination of the articular cartilage after experimentally induced OA Articular cartilage of the ... role in canine chondrocyte death and cartilage degradation These findings indicate that the maintenance of hypoxic conditions in cartilage inhibits articular chondrocyte apoptosis and may suppress ... increased the activation of caspase-8 under normoxic conditions, but that caspase-8 activation was inhibited under hypoxic conditions In addition, the enhancing effect of proteasome inhibition...
- 11
- 461
- 0
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt
... Holst, O & Brade, H (1997) Structural and serological characterisation of the O-speci c polysaccharide from lipopolysaccharide of Acinetobacter calcoaceticus strain (DNA group 1) Eur J Biochem 243, ... Fig Section of the ROESY spectrum of oligosaccharide Monosaccharide labels are as indicated in Fig NOE cross-peaks are in black, in antiphase with diagonal (grey lines) Spectrum was recorded at ... analysis of oligosaccharide monophosphates obtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota and Escherichia coli expressing the genusspeci c epitope of Chlamydia...
- 14
- 715
- 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt
... 50-lL reaction mixture containing 1ã LA Taq buffer (Takara Shuzo), 2.5 mm MgCl2, 0.4 mm dNTP, 0.2 mm each primer (5Â-GGAAT TCCATATGTCCGCACCTTCCACCAGCACCG-3Â and 5Â-GGGAAGCTTTCAGCCAAGCAGCTCTTTCAGG-3Â), ... Chemical Industries (Osaka, Japan) Culture and screening of bacteria Bacterial strains were cultivated for 1520 h at 30 C in 0.5 mL screening medium containing citric acid (0.5 gặL)1), FEBS Journal ... acted on a- oxohexanoate, phenylpyruvate, a- oxobutyrate, uoropyruvate, a- oxovalerate, a- oxoisocaproate, a- oxo-octanoate, and hydroxypyruvate However, branched-chain a- oxo acids, such as a- oxoisovalerate...
- 7
- 518
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25