0

proposals for the treatment of users of alcohol and other drugs a psychoanalytic reading

Báo cáo y học:

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Y học thưởng thức

... de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the current study include a lack of comparison group and lack of blinding ... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients ... low back pain Pain Physician 1999;2:59-64 Manchikanti L, Pampati V, Fellows B, et al The diagnostic validity and therapeutic value of lumbar facet joint nerve blocks with or without adjuvant agents...
  • 4
  • 599
  • 0
Báo cáo y học:

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Y học thưởng thức

... and carries significant risks The anterior approach requires a transthoracic approach with close proximity to the major abdominal and thoracic organs and neurovasculature [4], and posterior approaches ... Thoracic radiculopathy is rare, as evidenced by the paucity of literature regarding the appropriate management of these patients In our experience, patients with thoracic central and foraminal ... central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch Materials and Methods Twelve patients were treated with endoscopic laminoforaminoplasty...
  • 3
  • 506
  • 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Môi trường

... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the ... laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis ... Figure Behavior of nitrate and nitrite at the end of the aerobic tank Behavior of Nitrobacter species The analysis of nitrite oxidizing bacteria was performed with PCR and FISH By both of PCR and FISH...
  • 8
  • 572
  • 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Môi trường

... concentration (mg/L); qm and b are constant characteristic of the system for the Langmuir model that can be considered as an indicator of adsorptive capacity and appetency, respectively; and KF and ... the increased HRT of the adsorption tank From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the adsorption ... REFERENCES Standard Methods for the Examination of Water and Wastewater (1995) 19th edn, American Public Health Association/American Water Works Association/Water Environment Federation, Washington...
  • 8
  • 686
  • 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Sức khỏe giới tính

... diagnosis) The 5-year survival rate for metastatic colorectal disease is 12% 2.4 The management of metastatic colorectal cancer is mainly palliative and involves a combination of specialist treatments ... of the patients in the cetuximab monotherapy arm of the RCT The data from the monotherapy arm NICE technology appraisal guidance 118 15 were adjusted to remove the impact of cetuximab using an ... with metastatic colorectal cancer 6.2 The Committee was aware of other ongoing clinical trials with bevacizumab and cetuximab as part of different treatment regimens • The TREE-2 trial is a randomised...
  • 34
  • 853
  • 0
Hydroxyurea for the Treatment of Sickle Cell Disease docx

Hydroxyurea for the Treatment of Sickle Cell Disease docx

Sức khỏe trẻ em

... hydroxyurea treatment? What are the barriers to the use of hydroxyurea treatment (and other therapies) for patients who have sickle cell disease and what are the potential solutions? What are the future ... selected data elements against the original articles If there was a discrepancy between the data abstracted and the data appearing in the article, this discrepancy was brought to the attention of the ... electronic and hand searching On March 15, 2007, we ran searches of the MEDLINE® and EMBASE® databases A supplemental search targeting essential thrombocythemia was added to the MEDLINE and EMBASE searches...
  • 298
  • 1,113
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học

... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
  • 9
  • 634
  • 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt

Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt

Báo cáo khoa học

... PE38) has undergone several early-phase clinical trials for the treatment of B cell malignancies [35–37] These trials have validated the use of CD22 as a target and highlighted several potential ... a family of enzymes that catalyze the formation and breakage of disulfide bonds in proteins [63] They are abundant not only in the endoplasmic reticulum (ER) and Golgi, but also in other intracellular ... DT and CE), however, demonstrates that bacteria have 4690 J E Weldon and I Pastan found the diphthamide residue an appealing target to differentiate themselves from archaea and eukaryotes Because...
  • 18
  • 528
  • 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Sức khỏe phụ nữ

... Hay-Smith (2002) A A = available in English only as abstract; a = According to Australian National Health and Medical Research Council Hierarchy of Evidence (1998); b = Mean age (SD) unless otherwise ... quantity and quality of the educational information about the condition and PFM function The impact of these factors on the outcome of treatment has yet to be evaluated Furthermore, it has been ... with adjunctive therapy or the actual exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing...
  • 28
  • 738
  • 0
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx

Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx

Sức khỏe giới tính

... 2008 American Urological Association Education and Research, Inc.® Abbreviations and Acronyms ASTRO = American Society for Therapeutic Radiology and Oncology AUA = American Urological Association ... comments, the best practice statement was submitted to and approved by the PGC and the Board of Directors of the AUA Funding of the Panel and of the PGC was provided by the AUA, although Panel members ... AT, VanBuskirk RG, Baust JG, Gage AA and Baust JM: Targeted induction of apoptosis via TRAIL and cryoablation: a novel strategy for the treatment of prostate cancer Prostate Cancer Prostatic...
  • 51
  • 417
  • 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE

SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE

Tiến sĩ

... surface acetate and nitrogen dioxide or the reaction of surface acetyl radical and nitrate Both surface acetate and acetyl radical are derivative products that generate from the same source, acetaldehyde ... These maintain a rather strong synergistic effect between Mn and Ce species on the nanometer scale for the aged alumina-modified catalyst, and increase the amount of available active oxygen for ... three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine software package CasaXPS (Casa Software Ltd., UK) All spectra were calibrated for a...
  • 117
  • 376
  • 0
báo cáo hóa học:

báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf

Hóa học - Dầu khí

... preclinical data supporting the use of Alemtuzumab as a therapeutic agent for ovarian cancer patients Materials and methods Tissues Stage III epithelial ovarian cancer (n = 10), and ductal breast cancer ... been well established as an immunotherapeutic target antigen In fact, an anti-human CD52 antibody therapy, Alemtuzumab (Campath) has been developed and is FDA approved for the treatment of CD52 expressing ... inactivated sera, the majority of VLC are viable Annexin V (-) and PI (-) cells In contrast, in the presence of Alemtuzumab and sera (2), the majority of VLC are Annexin V+ and/ or PI + indicating the...
  • 14
  • 728
  • 0
báo cáo hóa học:

báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx

Hóa học - Dầu khí

... chemotherapy drugs include traditional drugs that target the cell cycle, for example, DNA alkylating drugs, and newer investigational drugs that target cell surface receptors and associated pathways, ... JT, Ransohoff J, Mealey J, Strike TA, Pistenmaa DA: Randomized trial of three chemotherapy regimens and two radiotherapy regimens in postoperative treatment of malignant glioma Journal of Neurosurgery ... Senanayake LFN, et al.: Randomized trial of procarbazine, lomustine, and vincristine in the adjuvant treatment of high-grade astrocytoma: A Medical Research Council Trial Journal of Clinical...
  • 14
  • 492
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc

Hóa học - Dầu khí

... and T1, and second, between T2 and T3) and treatment (EE or ER) as fixed factors, subject as random factor and the baseline value at the start of the relevant period (i.e., T0 and T2) as covariate ... one did, and in fact the task was well tolerated Furthermore, there was no degradation of performance at the end of the adaptation phase as compared to the final portion of the wash-out phase One ... a chair, with their torso and wrist restrained by means of suitable holders, and grasped the handle of a planar robotic manipulandum [33] with their most affected hand The position of the seat...
  • 11
  • 596
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx

Hóa học - Dầu khí

... parallel 1.8 mm Kirschner wires from the tip of the olecranon and a 18 gauge wire in a figure -of eight fashion Major intraoperative goal was the perforation of the ulnar Mayo Classification for ... contributions BC wrote the paper NS and ES collected and statistically analyzed the data CD and JP conceived, designed and revised the study Each author read and approved the final manuscript References ... olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs (C) at years postoperatively showed signs of...
  • 6
  • 492
  • 0
báo cáo hóa học:

báo cáo hóa học:" Long-term follow-up on the use of vascularized fibular graft for the treatment of congenital pseudarthrosis of the tibia" pdf

Hóa học - Dầu khí

... was applied in cases and contralateral VFG was applied in cases, in which one was for the initial trial of VFG, and the other was for the second trial of VFG after failure of bone consolidation ... years (at 19 years old) after the surgery The average term was 10.6 years and the average age was 18.3 years old It seemed to be characteristic that these pains appeared at late adolescence These ... treated with a brace and it healed Ankle pain Ankle pain was seen in out of the cases, regardless of its severity These pains appeared 12 years (at 19 years old), years (at 17 years old) and...
  • 7
  • 502
  • 0
báo cáo hóa học:

báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot

Hóa học - Dầu khí

... T12 L1 L1 T11 T11 T11 L1 L1 T12 MVA MVA MVA MVA MVA MVA MVA MVA MVA Fall Fall MVA Fall MVA MVA Fall MVA MVA Fall MVA MVA Fall MVA MVA Fall MVA Fall Fall MVA MVA MVA FD UB UB UB UB UB UB UB UB TRS ... given the final approval, HKK has contributed in drafting the manuscript and designing of data and revising it critically, KCN has contributed in acquisition of data and analysis and interpretation ... drafting the manuscript and data analysis, HSY has contributed acquisition of data and revising it critically, JHH has contributed in acquisition of data, revising the manuscript critically and...
  • 6
  • 519
  • 1
báo cáo hóa học:

báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc

Hóa học - Dầu khí

... is a chance of intra-articular pin placement, causing septic arthritis and a risk of damaging the growth plate An external fixator is also used for the treatment of paediatric supracondylar fractures ... the site, the pattern of the fracture and its associated injury When treating the displaced supracondylar fracture, the traditional method of traction may fail due to the unbalanced pull of the ... this article as: Lam et al.: The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report Journal of...
  • 6
  • 438
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

Hóa học - Dầu khí

... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients,...
  • 7
  • 531
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

Hóa học - Dầu khí

... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients,...
  • 7
  • 802
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25