proof of proposition 3 1 and proposition 3 2
Báo cáo y học: " Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus" pps
... proteins VP3, VP2 and a hypothetical protein of BmCPV1, DpCPV1 and LdCPV14, respectively [ 13 , 20 , 21 ] Function of VP3 protein of BmCPV1 is not exactly known but probably codes for spike protein [ 13 ] Therefore ... accession No: HM 23 0 690) Similarly, S3 consisted of 37 84 nucleotides having a long ORF of 36 30 nucleotides and could encode a protein of 12 10 amino acids with molecular mass of ~ 13 7 kDa (p 13 7 ) Twenty ... http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were expressed in E coli M15 cells as insoluble 14 1 kDa (Fig 2A,...
- 11
- 307
- 0
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx
... matrix J Biol Chem 2 61, 10 765 10 7 71 23 Miles LA, Dahlberg CM & Plow EF (19 88) The cellbinding domains of plasminogen and their function in plasma J Biol Chem 2 63, 11 928 11 934 24 Thewes T, Constantine ... mAb A10 .2 or the K1-LBS by mAb 34 D3 on Lys-Pg only partially inhibits both its binding to fibrin (Fig 3A, IC50 A10 .2 ¼ 29 0 nm, IC50 34 D3 ¼ 420 nm) and its activation (Fig 3B, IC50 A10 .2 ¼ 18 5 nm, ... respectively, cells and fibrin: A10 .2 ¼ 9 .2 nM and nM; 34 D3 ¼ 13 . 1 nM and nM; mAb mix ¼ 11 .8 nM and nM K4-LBS is permanently exposed, supports this hypothesis Blockage by mAb A10 .2 of K4-LBS exposed...
- 14
- 558
- 0
Tài liệu Báo cáo Y học: Binding of gelsolin domain 2 to actin An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin pptx
... 1 10 18 28 84 1 03 11 2 12 5 11 9– 13 2 34 7 36 5 33 8 34 8 36 0 37 2 35 5 37 5 1 .3 mM ND No binding No binding No binding No binding 2. 9 mM mM 40 mM 30 mM mM 2. 0 mM 2. 0 mM ND ND No binding 50 mM 2. 0 mM Binding ... binding 22 23 24 25 26 27 28 29 30 31 32 33 34 35 by cofilin and gelsolin segment substantiates their structural relationship J Biol Chem 27 2, 32 750 32 758 McGough, A., Chiu, W & Way, M (19 98) Determination ... J Biol Chem 2 71, 20 516 – 20 5 23 10 Cunningham, C.C., Stossel, T.P & Kwiatkowski, D.J (19 91) Enhanced motility in NIH 3T3 fibroblasts that overexpress gelsolin Science 2 51, 1 23 3 1 23 6 11 McLaughlin,...
- 11
- 460
- 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx
... 4.05, 3. 75 4. 61 4. 02 3. 74 3. 99 3. 69 a 4. 62 4.99 4.97 3. 32 4.09 3. 76 3. 51 3. 92 3. 95 3. 62 4 .16 4 .36 3. 60 3. 87 3. 97 4.05, 3. 75 3. 95, 3. 73 4. 61 4.96 4. 03 3.58 3. 74 3. 70 4.00 3. 44 3. 69 3. 66 a 3. 87, 3. 77 ... penneri strain 40 41 25 600 < 10 0 < 10 0 32 00 32 00 25 600 < 10 0 < 10 0 32 00 32 00 12 800 < 10 0 < 10 0 < 10 0 < 10 0 12 800 < 10 0 < 10 0 < 10 0 < 10 0 6400 < 10 0 < 10 0 5 12 00 6400 < 10 0 < 10 0 NT NT < 10 0 NT NT O-antiserum ... b-D-GalpNAcII- (1 ® a-D-GlcpII- (1 ® C1 C2 C3 C4 C5 C6 10 5.6 10 2. 6 99.7 74 .3 52. 5 68.8 76.9 81. 6 81 .3 70.4 69 .2 77 .1 75.4 75.7 71. 5 66.8 61. 9 62. 2 10 5 .1 54 .1 72. 5 69 .1 76 .2 62. 5 10 5.6 10 2. 6 99.8 74 .3 52. 4...
- 6
- 560
- 0
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... Sugimura, T (19 90) 24 25 26 27 28 29 30 Calyculin A, an inhibitor of protein phosphatases, a potent tumor promoter on CD -1 mouse skin Cancer Res 50, 35 21 35 25 Li, Y.-M & Casida, J.E (19 92) Cantharidin-binding ... inhibitors of PP1 and PP2A [ 23 , 24 ], showed effects similar to that of OA (Fig 4) Deltamethrin, a specific inhibitor of PP2B [25 ], and phenylarsine oxide, a putative inhibitor of tyrosine phosphatases [26 ], ... post-translationally modified form of tubulin Eur J Cell Biol 42, 28 8 29 4 12 Arce, C.A & Barra, H.S (19 83) Association of tubulinyl-tyrosine carboxypeptidase with microtubules FEBS Lett 15 7, 75–78 13 Sironi, J.J.,...
- 9
- 301
- 0
báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot
... 27 .8 1, 1 81 ± 10 91 8,4 21 ± 2, 684 930 , 916 ± 650,0 21 527 ,5 93 ± 45 ,14 17 33 8 ± 33 0 10 9.0 ± 52. 9 1, 9 62 ± 1, 665 39 .4 ± 32 .1 0. 01 23 0. 014 5 0. 018 5 0. 019 0 0. 022 0 0. 020 9 0. 024 9 0. 02 63 0. 035 2 0. 038 1 0.04 21 ... hsa-miR -19 a hsa-miR -20 0b hsa-miR-5 42- 3p hsa-mir- 625 hsa-miR -10 6b hsa-miR -20 b 4 .11 2. 63 2. 47 2. 43 2. 21 1. 93 1. 92 1. 86 1. 86 1. 81 1.76 1. 73 1. 70 1. 66 1. 63 1. 6 1. 48 1. 43 1. 42 1 .33 1 . 31 hsa-miR- 13 3 a hsa-miR-504 ... 26 † 49 ± 33 *† 82 ± 16 73 ± 23 * 58 ± 27 † 64 ± 24 23 ± 29 89 ± 62 ± 35 82 ± 26 * 20 0 ± 11 5 37 7 ± 2 21 2, 725 ± 8 53 23 7 ± 61* 566 ± 29 0† 15 5 ± 67 4 41 ± 4 43 890 ± 33 6* 2 53 ± 10 7* 2, 0 12 ± 10 88* % Reactive...
- 17
- 524
- 0
Báo cáo toán học: "A combinatorial proof of Postnikov’s identity and a generalized enumeration of labeled trees" pdf
... |Dn | = 2n (n + 1) n 1 In this section we give a generalization of this result the electronic journal of combinatorics 11 (2) (20 05), #N3 D= 10 12 f 11 9 γ◦φ 11 10 11 10 =F bi Figure 3: The bijection ... ≥ 1, fn (t) is given by n 1 (i + 1) t + (n − i) (11 ) (2i + 1) t + (n − i) ( 12 ) fn (t) = t i =1 For n ≥ 1, pn (t) is given by n 1 pn (t) = t i =1 Note that (11 ) and ( 12 ) are generalizations of ... generalizations of |Tn +1 | = (n + 1) n and |Pn +1 | = (n + 1) ! Cn Remark In spite of the simple expressions, we have not proved (8), (11 ) and ( 12 ) in a bijective way Also a direct combinatorial proof of Theorem...
- 9
- 272
- 0
Báo cáo toán học: "Graphs Associated with Codes of Covering Radius 1 and Minimum Distance 2" ppsx
... electronic journal of combinatorics 15 (20 08), #R68 3 X X X 0 Figure 5: The partial Latin square equivalent {000, 011 , 022 , 10 1, 11 0, 13 3 , 20 2, 2 13 , 2 21 , 23 0 , 30 3, 32 0, 33 2} to the code Figure ... vertices of degree six, 11 2, 13 0 , 33 2, 31 0, GB has only three vertices of degree six, 13 2 , 33 1, 31 2 LA, LB, LC and LD are non-equivalent There are four non-equivalent (3, 10 , 2) 4 codes Theorem 15 No ... S( 23 ) squares with row of 0 12 X, 021 X and 023 X are equivalent to squares with row of 013 X, 0 31 X and 0 32 X respectively Thus only nonextendable partial Latin squares with row of 0 12 X, 021 X and 023 X...
- 17
- 252
- 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... et al Journal of Experimental & Clinical Cancer Research 2 011 , 30 :16 http://www.jeccr.com/content /30 /1/ 16 Received: 30 September 2 010 Accepted: February 2 011 Published: February 2 011 References ... (Table 2) Restage before RIT: CT, PET, BMB Zevalin® FCR -28 CYCLES 11 .1- 14.8 MBq/Kg CR/CRu or PR F: 25 mg/m2 i.v days 1 -3 C: 1gr/m2 i.v day R: 37 5mg/m2 i.v day Figure Treatment schema Restage 12 weeks ... cycles of FCR: fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 37 5 mg/m2 was given on day of each cycle every 28 ...
- 5
- 287
- 0
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx
... transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs00 23 3 958_m1 MMP -2 Hs00 23 4 422 _m1 HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP -1- S GATCGAGAGGATGTTATAAAGCATG ... 4, 12 11 Geneva 14 , Switzerland and 2Department of Pathology and Immunology, Geneva University Hospital and School of Medicine, rue Michel Servet 1, 12 11 Geneva 14 , Switzerland 19 Received: 10 ... 19 Received: 10 December 20 09 Revised: April 2 010 Accepted: 29 April 2 010 Published: 29 April 2 010 21 20 ArthritisGoffin et al.;Therapy 2 010 , 12 :R 73 under the terms of the Creative Commons Attribution...
- 14
- 286
- 0
The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma
... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11 .3 Mitotic disruption and autophagy ... 51 3. 11 HDAC Activity Assay 52 3. 11 .1 Extraction of nuclear protein 52 3. 11 .2 Fluorometric HDAC Activity Assay 52 3. 12 RNA isolation 53 3. 13 Microarray...
- 168
- 372
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... - 32 0 +1 Luc -15 4 E2 +1 +1 Luc -975 +1 Luc - 32 0 Prm3 -19 79 - 13 9 4 +1 Luc +1 Luc -404 Prm2 E1b -33 08 - 13 9 4 +1 Luc -975 E1 -5895 -8500 +1 Luc -15 4 +1 Luc -10 6 +1 Luc -50 pGL3Basic +1 Luc +1 Luc +1 ... Prm3 activity In contrast, further 5¢ -11 8 +1 + 11 9 +786 E2 +1 Luc -11 8 Luc +11 9 Luc 10 Luciferase Activity (RLU) B - 13 9 4 -404 -11 8 +1 +1 19 +786 E2 +1 Luc **** FEBS Journal 27 2 (20 05) 1 036 10 53 ... AP -1 +1 Promoter Luciferase Activity (RLU) AP -1 - 13 9 4 +786 - 13 9 4 E2 - 13 9 4 +1 Luc - 13 9 4 +1 Luc - 13 9 4 +1 Luc **** +1 Luc +786 E2 *** - 13 9 4 +1 Promoter -404 +1 Luc +1 Luc -15 4 +1 Luc +1 Luc -15 4 +1...
- 18
- 509
- 0
Báo cáo khoa học: Anti-HIV-1 activity of 3-deaza-adenosine analogs Inhibition of S-adenosylhomocysteine hydrolase and nucleotide congeners pot
... hydrolase 0.007 0.0 23 0 .24 0. 83 3.9 28 .0 30 .1 50.5 ± ± ± ± ± ± ± ± 0.0 02 0.008 0.04 0 .15 0.7 4 .1 3. 0 7 .3 Ó FEBS 20 03 Anti-HIV -1 activity of 3- deaza-adenosine analogs (Eur J Biochem 27 0) 35 11 hydrolase ... 0.005a 0.001a 0.06a 0 .3 0.06a 0.4 0 .3 0 .3 A 018 isolate 0. 018 0. 016 0 .22 2. 84 0 .20 4.8 2. 5 2. 0 ± ± ± ± ± ± ± ± 0.009a 0.005a 0.02a 0 .3 0.02a 0 .2 0 .3 0 .2 The IC50 values from Mayers et al [10 ] Ki (lM) ... AA -2 (AK–, dCK–) V79 (TK+) V79 (TK–) 0.64 0.59 3. 4 2. 6 0 .25 0 .28 1. 0 1. 4 ± ± ± ± 0.07 0.09 0 .27 0 .10 ± ± ± ± 0. 03 0. 02 0.05 0.06 35 12 R K Gordon et al (Eur J Biochem 27 0) Ó FEBS 20 03 amount of 3- deaza-nucleotides...
- 11
- 303
- 0
Influences of the si(1 1 3) anisotropy on ge nanowire formation and related island shape transition
... 27 82 [3] G Medeiros-Ribeiro et al., Science 27 9 (19 98) 35 3 [4] J Knall, J.B Pethica, Surf Sci 26 5 (19 92) 15 6 [5] H Omi, T Ogino, Appl Phys Lett 71 (19 97) 21 63; H Omi, T Ogino, Phys Rev B 59 (19 99) ... Phys Lett 76 (20 00) 35 34 [10 ] P M€ ller, R Kern, Surf Sci 457 (20 00) 22 9 u [11 ] F.M Ross, J Tersoff, R.M Tromp, Phys Rev Lett 80 (19 98) 984 [ 12 ] J Tersoff, Phys Rev B 43 (19 91) 937 7 ... all of the side faces of elongated islands are faceted with (1 9)/(5 9) at an angle of 16 ° with respect to the substrate surface, their 3 ends are faceted with (15 17 ), (1 1) and (3 15 17 )...
- 7
- 340
- 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot
... and human (AGP1_HUMAN; Q1 538 9 and AGP2_HUMAN; O1 51 23 ) (iv) Ficolins: ficolin A and B from pig (FICOLA_PIG; L1 23 4 4 and FICOLB_PIG; L1 23 4 5), mouse (FICOLA_MOUSE; AB0078 13 and FICOLB_MOUSE; AF0 6 32 17 ), ... AB 024 737 .1 and TECL5B_TACTR; AB 024 738 .1) (iii) Angiopoietin: angiopoietin and precursors from mouse (AGP1_MOUSE; O08 538 and AGP2_MOUSE; O35608), bovine (AGP1_BOVIN; O18 920 and AGP2_BOVIN; O778 02) , ... nucleotides 10 0 10 2 to nucleotides 22 42 22 44(stop); the Ó FEBS 20 04 Activation of sponge cells by (1 3) -b-D-glucan (Eur J Biochem 2 71) 19 29 Fig The Suberites domuncula potential beta -1 ,3- glucan-binding...
- 14
- 299
- 0
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc
... ) 1 03: Vmax (mmol:min 21 : mg 21 ) 1 03: (Vmax/Km) (min 21 : mg 21 ) ln (Vmax/Km) G3G G3G3G G3G3G3G G3G3G3G3G G3G3G3G3G3G 16 .5 5.0 1. 9 2. 0 2 .1 0 .36 5.5 14 16 18 0. 02 1. 1 7.4 8.0 8.6 21 0 . 73 26 .80 24 . 91 24 . 83 ... 12 5 70 15 630 570 440 31 5 2 83 25 2 2. 5 4.6 6 .3 21 47 63 1. 8 2. 5 8.4 18 .8 25 .2 10 0 90 70 50 45 40 6 12 6 A A Kulminskaya et al (Eur J Biochem 26 8) q FEBS 20 01 General properties Fig SDS/PAGE of the ... G4G4G3G and G4G3G were produced by digestion of barley glucan with a 1 ,3- 1, 4-bglucanase and purified [26 ] The G3G3G3G3G3G, G3G3G3G3G, and G3G3G3G were prepared by formic acid hydrolysis of curdlan...
- 9
- 554
- 0
The Project Gutenberg EBook of Darwin, and After Darwin (Vol. 1 and 3, of 3), by George John docx
... mature and greatly magnified Stages in the formation of the polar bodies in the ovum of a star-fish Fertilization of the ovum of an echinoderm 10 0 10 7 11 1 1 13 12 1 12 2 1 23 12 5 12 6 Fertilization of ... segmentation, drawn in perspective Formation of the gastrula of Amphioxus Gastrulation Gastrula of a Chalk Sponge 12 7 12 9 13 1 13 2 , 13 3 13 5 13 5 13 7 13 8 13 9 Prophysema primordiale, an extant gastræa-form ... Skeleton of Polar Bear 16 7 16 8 16 8 16 8 16 8 16 8 16 9 16 9 17 0 17 0 17 1 17 1 17 2 17 4 Skeleton limb of Man, Dog, Hog, Anterior of Lion Sheep, and Horse Posterior limb of Man, Monkey, Dog, Sheep, and Horse...
- 1,156
- 437
- 0
ARNOLD, K. (1999). Design of Gas-Handling Systems and Facilities (2nd ed.) Episode 1 Part 3 pps
... 547.87 10 71. 0 44. 010 4 93. 0 28 .0 13 22 7 .3 34.076 1 036 .0 6 72. 6 34 3 .37 16 .0 43 667.8 707.0 30 .070 550.09 44.097 616 .3 666. 01 734 .98 529 58 . 12 4 58 . 12 4 550.7 765.65 490.4 72 .15 1 829 ,10 488.6 845.70 72 .15 1 ... 4.696 psia at Boiling Point, Btu/lb 21 9 .22 21 0 . 41 1 83. 05 16 5.65 15 7. 53 1 53. 59 14 7. 13 1 43. 95 13 6 . 01 129 . 53 1 23 . 76 11 8.68 40 Design of GAS-HANDLING Systems and Facilities Natural Gas Sensible Heat ... Shear Ring 20 21 22 23 24 25 26 27 , 28 29 30 31 32 33 34 35 36 37 38 39 Slip-on Backing Flange Floating Head Cover—External Floating Tubesheet Skirt Packing Box Packing Packing Gland Lantern...
- 25
- 348
- 0
Báo cáo y học: "The triterpenoid CDDO inhibits expression of matrix metalloproteinase-1, matrix metalloproteinase-13 and Bcl-3 in primary human chondrocytes" ppt
... inhibited by 36 % (P < 0 .1) with 30 0 nM CDDO, by 49% (P < 0. 01) with µM CDDO, and by 83% (P < 0. 01) by µM CDDO Similar patterns emerged for MMP- 13 ( 63% , 81% , and 99%) and Bcl -3 (33 %, 61% , and 86%) ... decreased expression of IL -1- induced MMP -1 and MMP- 13 MMP -1 expression was decreased by 99% (P < 0. 01) and MMP- 13 by 96% (P < 0. 01) As was observed with SW 13 5 3 cells, MMP- 13 expression was significantly ... SW- 13 5 3 and human primary chondrocytes (data not shown) Effect of overexpression of Bcl -3 on the inhibition of MMP -1 by CDDO To examine further the role of Bcl -3 in IL -1- induced MMP -1 and MMP -13 ...
- 7
- 348
- 0
Báo cáo khoa học: "Expression of the metalloproteases MMP-1, MMP-2, MMP-3, MMP-9, MMP-11, TIMP-1 and TIMP-2 in angiocentric midfacial lymphomas" potx
... -2, -3, -11 ,- 13 , -1 -2, -3, -11 ,- 13 , -1 -1, -2, -11 -1, -2, -3, -11 ,- 13 -1, -2, -3 -2 -1, -11 -1 -1, -2, -3, -11 ,- 13 -1, -2, -3, -11 ,- 13 -1, - 13 -1, -2, -3, -11 -1 -1, -2, -3, -9, -11 ,- 13 -1, -2, -3, -11 ,- 13 -1 -1, -2, -3 -1, -2 -1, -2, -3, -11 ,- 13 , ... -1, -2, -3, -11 ,- 13 , -1 -1, -9 -1, -2 -1, -3, -11 -1 -1, -2, -3 -1, -11 -1, -3, -11 -11 -1, -3, -11 -1, -2, -3, -11 -2 -1, -2, -3, -9, -11 -1, -3 -1, -2 -1, -2 -1 -1 -1, -2 -1, -2 -1, -2 -1, -2, -3, - 13 -1 -1, -3, -9 -2 -1, -11 -1 ... -1, -2, -11 -2 10 11 12 13 14 15 16 17 18 19 20 Endothelium -11 -1, -9, -11 -1, -11 -1, -11 -2 -1, -2, -3, -9, -11 -1 -1, -3, -11 -1, -9, -11 ,- 13 -1, -2 -3, -9, -11 Epithelium -1, -2, -3, -11 ,- 13 -1 -2, -3, -11 ,- 13 , ...
- 9
- 247
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25