progress indicators using a series of dots a rotating line or elapsed time
Báo cáo y học: "Single-step autoantibody profiling in antiphospholipid syndrome using a multi-line dot assay" pptx
Ngày tải lên :
12/08/2014, 17:22
... dot assay Assay performance analysis of ELISA and MDLA demonstrated similar data regarding assay variation and functional assay sensitivity Data are shown in Additional file For comparison of ... GmbH, Dahlewitz, Germany) Statistical analysis and determination of assay performance characteristics Intra- and inter-assay coefficients of variations (CV) were calculated The functional assay sensitivity ... phospholipids as required by Nash et al, demonstrating that omitting the classical anti-CL antibody assay caused 25% of APS patients to be assessed as false-negative [36] Remarkably, the appearance of aPL...
- 8
- 249
- 0
![Báo cáo khoa học: " Ventilator-associated pneumonia using a heated humidifier or a heat and moisture exchanger: a randomized controlled trial [ISRCTN88724583]" ppsx](https://media.store123doc.com/images/document/2014_08/15/medium_yan1407871472.jpg)
Báo cáo khoa học: " Ventilator-associated pneumonia using a heated humidifier or a heat and moisture exchanger: a randomized controlled trial [ISRCTN88724583]" ppsx
Ngày tải lên :
13/08/2014, 02:24
... it was caused by microorganisms that were never carried in the patient's oropharyngeal flora heated humidifiers (HHs) ated pneumonia using of patients remaining free of ventilator-associCumulative ... Qualitative variables are reported as percentages, and were compared with the chi-squared test or with Fisher's exact test as appropriate The probability of remaining free of VAP was calculated ... anesthetic gases during anesthesia using heat and moisture exchangers Anaesthesiol Reanim 1992, 17:133-144 Kugimiya T, Phuc TG, Numata K: Laboratory evaluation of heatand-moisture exchangers J Anesth...
- 7
- 317
- 0
Báo cáo hóa học: " Temperature-Dependent Site Control of InAs/GaAs (001) Quantum Dots Using a Scanning Tunneling " pptx
Ngày tải lên :
21/06/2014, 08:20
... were remained at least 40 s and collapsed less than 1000 s Then, we fabricated InAs nano dots at 300°C under In and As4 irradiations These were not 123 Y Okada, R Oshima, A Takata, J Appl Phys ... increase crystal quality of nano structure, we tried to fabricate at 430°C under As4 irradiation After the InAs WL growth at 500°C, a substrate temperature has decreased to 430°C under As4 irradiation ... procedure: after removing oxides at 580°C, about 170 nm of a GaAs buffer layer was grown at 560°C under Ga and As4 fluxes, 1.0 10-5 Pa and 6.0 10-4 Pa, respectively After the GaAs buffer layer growth, about...
- 5
- 356
- 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
Ngày tải lên :
25/10/2012, 11:00
... of Laboratory Animals Statistical analysis The results were recorded by the principal investigator and analyzed statistically upon completion of the study The statistical analysis was performed ... control and air leaks when the authors performed recurrent thoracotomy for any reason, and confirmed the efficacy of TachoSil® as an anti-adhesive agent by performing an experimental rat study ... J Thorac Cardiovasc Surg 2001;121:657-67 Onen A, Sanli A Surgical treatment of synchronous and metachronous lung cancer Tur Toraks Der 2004;5:201-7 Tanaka A, Abe T, Matsuura A Prevention of postoperative...
- 7
- 453
- 0
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
Ngày tải lên :
03/11/2012, 10:09
... the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... dimension analysis of COP data is more sensitive than traditional measures and that it may provide a good screening tool or measure of disease progression The disadvantage of this type of fractal analysis ... in gait and posture data may serve as an indicator of pathology or impairment Surrogate data analysis is used to test for a system’s non-linearity This check for non-linearity via the use of surrogate...
- 10
- 457
- 0
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks
Ngày tải lên :
22/03/2013, 15:01
... the field data In particular, these differences are increase at the high strain rate range The reason is that ANN model has not a lot of database on the high strain rate To eliminate this effect ... hidden layer – one output layer is used ANN model was designed to build and operate a database for the physical properties of the soil and results of consolidation test, to learn the database, and ... neural network model for estimating of proper strain rate form soil parameter is proposed The back-propagation neural network program adopted in the present study essentially followed the formulations...
- 5
- 516
- 1
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
Ngày tải lên :
05/09/2013, 16:11
... and analysis The collection of reactors effluents was done daily to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are ... bioreactor may be employed as an alternative of the anaerobic reactors for treating several kind of wastewater such as industrial or municipal effluents References [1] Shivayogimath CB, Ramanujam ... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared the start-up...
- 8
- 408
- 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
Ngày tải lên :
05/09/2013, 16:11
... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter, ... disposal of hazardous waste (co-disposal) Since the data available on the quantity, age, and composition of the refuse in the landfill are limited, using a more sophisticated calculation was not attempted ... Landfill type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: [11] CAA = Clean Air Act (1970) K (year-1) 0.05 (Default) 0.02 0.04...
- 8
- 540
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
Ngày tải lên :
05/09/2013, 17:03
... grid arrangement is also best in the case of a VAWT for optimal power generation Wake, power and cost modeling of a HAWT 2.1 Jensen's wake modeling of a HAWT All the results reported to date in ... median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure Convergence history of ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
- 12
- 635
- 1
Tài liệu tiếng anh Điện tử công suất mạch MERS Voltage rating reduction of magnetic power supplies using a magnetic energy recovery switch
Ngày tải lên :
15/10/2013, 16:12
... supply and the coil Both these parts of energy pulsate and cause voltage fluctuations of the capacitors The capacitors must maintain the voltage within a range; therefore the capacitors must store ... discharges all of its charge and the voltage becomes zero Therefore, the total size of capacitors is reduced by using MERS In other words, dividing off the capacitor of MERS from the capacitors of ... Therefore, voltage rating reduction causes decreasing of the DC capacitors In general, the DC capacitors occupy large part of the power supply in volume The DC capacitors store energy as large as...
- 4
- 535
- 0
DC bus control of variable speed wind turbine using a buck boost converter
Ngày tải lên :
03/01/2014, 19:15
... Hydro-Québec, Natural Resources Canada and the Natural Sciences and Engineering Research Council of Canada VII [1] REFERENCES C.L Kana; M Thamodharan and A Wolf; “System management of a wind-energy ... B K Bose, and R J Spiegal, “Design and performance evaluation of a fuzzy-logic-based variable-speed wind generation system,” IEEE Trans Ind Applicat., vol IA-33, pp 956– 964, July/Aug 1997 [10] ... reach the operating point (k+1) Search rules of the various cases of operation are summarized in the table I 4 TABLE SUMMARY OF CONTROL ACTION FOR VARIOUS OPERATING POINTS ∆α ∆α > i ∆α < ∆P >0...
- 5
- 574
- 1
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
Ngày tải lên :
14/02/2014, 03:20
... TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan A nitrogen atmosphere was used for each trial Some analyses were performed on a Perkin Elmer-7 TGA with an ... indicated that Form I formed a heptahydrate at typical laboratory temperatures and quickly became anhydrous above approximately 60–80 °C in a dry atmosphere This conclusion was derived from TGA ... that this new peak represents a thermally formed crystalline material, a minor quantity of another crystalline form, or an unstable polymorph which converted back to Form III between the DSC and...
- 16
- 549
- 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
Ngày tải lên :
14/02/2014, 19:20
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT ... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT ... 3, and Identical products were formed by PCR of DENV-2 cDNA and RT-PCR Average amplicon location (nucleotides) Average amplicon size (bp) DENV-1 CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG...
- 12
- 795
- 0
Tài liệu A Series of Lessons in Raja Yoga docx
Ngày tải lên :
17/02/2014, 20:20
... degree and acuteness The animal may have a keener smell, taste, hearing and sight, but its sense of Touch is far beneath that of Man Anaxagoras is quoted as saying that "if the animals had hands and ... and just about returning to it again, for the atoms of the body are constantly changing That which appears as your flesh to-day, may have been part of a plant a few days before, and may be part ... Universal "I," and will endeavor to give him an idea of a greater, grander Self, transcending personality and Series of Lessons in Raja Yoga, by Yogi Ramacharaka 19 the little self that we are so apt...
- 101
- 536
- 0
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx
Ngày tải lên :
19/02/2014, 17:20
... the correct shade for direct composite resin restorations and can serve as a practical chairside alternative to the diagnostic wax-up It can also be used to create a lingual matrix for multilayered ... teeth shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic ... Assistant Professor in Operative Dentistry, Faculty of Dentistry, Laval University Quebec City, Canada laurie.st-pierre@fmd.ulaval.ca Dr Deborah S Cobb Associate Professor, Department of Operative...
- 5
- 378
- 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
Ngày tải lên :
20/02/2014, 04:20
... ParaMor (Monson, 2008) and Morfessor (Creutz, 2006) They used a natural language tagger which was trained on the output of ParaMor and Morfessor The goal was to mimic each algorithm since ParaMor ... Connectionist, and Statistical Approaches to Learning for Natural Language Processing, 370–384 E Atwell and A Roberts 2006 Combinatory hybrid elementary analysis of text (CHEAT) Proceedings of the PASCAL ... incorporating a probabilistic generative model.1 Their parameters can be estimated from either labelled data, using maximum likelihood estimates, or from unlabelled data by expectation maximization2...
- 9
- 557
- 0
Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf
Ngày tải lên :
20/02/2014, 09:20
... -22.37 Table 1: Interpretations of Lapata and Lascarides (2003) for finish video Lapata and Lascarides (2003) extend Utiyama’s approach to interpretation of logical metonymies containing aspectual ... European Chapter of the ACL, pages 168–177, Utrecht M Lapata and A Lascarides 2003 A probabilistic account of logical metonymy Computational Linguistics, 29(2):261–315 A Lascarides and A Copestake ... metonymic phrase in an imaginary context We evaluated interannotator agreement in terms of Fleiss’ kappa (Fleiss, 1971) and f-measure computed pairwise and then averaged across the annotators The agreement...
- 9
- 429
- 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
Ngày tải lên :
05/03/2014, 17:20
... (Molecular Devices, Sunnyvale, CA) Statistical analyses One-way ANOVA analyses with post-tests were performed using GraphPad Prism version 5.0 d, GraphPad Software, San Diego California USA [6] If data ... treated animals, performed necropsies and analyzed sperm All authors participated in experimental design and read and approved the final manuscript The authors declare that no actual or potential conflict ... tubules had a very short epithelial layer and increased lumen diameter due to the loss of all spermatocytes and spermatids (D) Tubules that appear to have a larger epithelial layer and smaller diameter...
- 15
- 967
- 0
Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx
Ngày tải lên :
06/03/2014, 16:20
... Maximum, of Average no $Mcontracts Average Maximum no of contracts Maximum Average no of FSC Codes Average Maximum no of FSC Codes Maximum Average no of contractor ID Average no of contractor ... performance incentives or commitment to improve Inadequate/poor past performance information Inadequate/poor past performance information Inappropriate scales of work Inappropriate scales of work ... describe Air Force data available for such an analysis, review indicators of prospective Air Force opportunities for applying improved PSM practices, examine the insights available from the data that...
- 105
- 394
- 0