program in c to add two numbers using function
Tài liệu Báo cáo khoa học: "Mining metalinguistic activity in corpora to create lexical resources using Information Extraction techniques: the MOP system" doc
Ngày tải lên :
20/02/2014, 15:20
... Metalinguistic
Knowledge from Texts, Selected papers from
CICLING-2000 Collection in Computer Science
(CCC); National Polytechnic Institute (IPN),
Mexico.
Vossen, P. and Copestake, A. 1993. Untangling ... machine-readable dic-
tionary.
3 Locating metalinguistic information in
text: two approaches
When implementingan IE application to mine
metalinguistic information from text, the first is-
sue to tackle ... dependent on other factors. A hybrid
approach that combines hand-crafted collocations
with classifiers customized to each pattern’s be-
havior and morpho-syntactic contexts in corpora
might offer...
- 8
- 459
- 0
Báo cáo khóa học: Development of recombinant inhibitors specific to human kallikrein 2 using phage-display selected substrates docx
Ngày tải lên :
30/03/2014, 13:20
... rACT
8.20
,5Â-TACCGCGGTCAAAATCACCCTCC
GTTCTCGAGCAGTGGAGACGCGTGA-3Â;rACT
6.3
,
5Â-TACCGCGGTCAAAATCACC
AGGAGGTCTATC
GATGTGGAGACGCGTGA-3Â;rACT
8.3
,5Â-TACCGCG
GTCAAAATC
AGGGGGAGATCTGAGTTAGTGGA
GACGCGTGA-3Â;rACT
6.7
,5Â-TACCGCGGTCAAAAT
C
AAGCTTAGAACAACATTAGTGGAGACCGCTG
A-3Â;rACT
6.1
,5Â-TACCGCGGTCAAAATCATGACAA
GATCTAACTTAGTGGAGACGCGTGA-3Â;rACT
5.18
,
5Â-TACCGCGGTCAAAATCACC
GAGCGTGTCTCG
CCCGTGGAGACGCGTGA-3Â (where underlined sequ-
ences encode new cleavage ... rACT
8.20
,5Â-TACCGCGGTCAAAATCACCCTCC
GTTCTCGAGCAGTGGAGACGCGTGA-3Â;rACT
6.3
,
5Â-TACCGCGGTCAAAATCACC
AGGAGGTCTATC
GATGTGGAGACGCGTGA-3Â;rACT
8.3
,5Â-TACCGCG
GTCAAAATC
AGGGGGAGATCTGAGTTAGTGGA
GACGCGTGA-3Â;rACT
6.7
,5Â-TACCGCGGTCAAAAT
C
AAGCTTAGAACAACATTAGTGGAGACCGCTG
A-3Â;rACT
6.1
,5Â-TACCGCGGTCAAAATCATGACAA
GATCTAACTTAGTGGAGACGCGTGA-3Â;rACT
5.18
,
5Â-TACCGCGGTCAAAATCACC
GAGCGTGTCTCG
CCCGTGGAGACGCGTGA-3Â ... sites in the reactive site loop),
using primers corresponding to the anking regions:
5Â-TACCGCGGTCAAAATC-3Â and 5Â-TCACGCGTGT
CCAC-3Â. PCR products were digested with SacII and
MluI restriction...
- 7
- 374
- 0
Financial Applications Using Excel Add-in Development in C/C++ pdf
Ngày tải lên :
31/03/2014, 10:21
... Search and Replace or Paste Function dialogs 375
9.5 Accessing Excel functionality using COM/OLE automation using
C+ + 376
9.5.1 Initialising and un-initialising COM 377
9.5.2 Getting Excel to recalculate ... recalculate worksheets using COM 379
9.5.3 Calling user-defined commands using COM 380
9.5.4 Calling user-defined functions using COM 382
9.5.5 Calling XLM functions using COM 383
9.5.6 Calling ... Add -in Manager Interface
How to turn a DLL into an add -in that Excel can load using the add -in manager: an
XLL. The functions that Excel needs to find in the DLL. How to make DLL functions
accessible...
- 587
- 4.7K
- 0
báo cáo khoa học: " Using intervention mapping to develop and adapt a secondary stroke prevention program in Veterans Health Administration medical centers" ppt
Ngày tải lên :
10/08/2014, 10:23
... approach San Francisco, CA: Jossey-Bass;
2006.
29. McEachan RR, Lawton RJ, Jackson C, Conner M, Lunt J: Evidence, theory
and context: using intervention mapping to develop a worksite physical
activity ... following programs and strategies: standardized
provider check-off list or discharge check-off list and
clinical reminders; training and education regarding
local reso urces and referral to such ... recommendations.
We included probes throughout the interviews to
delve into the research topics: current knowledge and
practices to prevent a second stroke; needs to support
providers in providing secondary...
- 11
- 291
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 1 doc
Ngày tải lên :
12/08/2014, 17:20
... are integrated
into Excel in Excel 2007), and some that provide complex additional functionality such
as the Solver add -in.
Add- ins come in two main flavours: interpreted macros and compiled code ... 2
1.2.1 VBA macros and add- ins 3
1.2.2 C/ C++ DLL add- ins 4
1.2.3 C/ C++ DLLs that can access the C API and XLL add- ins 4
1.2.4 C/ C++ /C# .NET add- ins 4
1.3 To which versions of Excel does this ... Using VBA to trap Excel events 59
3.5 Using VBA to create new functions 61
3.5.1 Function scope 61
3.5.2 Declaring VBA functions as volatile 62
3.6 Using VBA as an interface to external DLL add- ins...
- 59
- 529
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 2 pot
Ngày tải lên :
12/08/2014, 17:20
... User-defined functions (VB Macros) and add -in functions
Excel’s very useful
INDIRECT() function creates a reference to a range indirectly, i.e.,
using a string representation of the range address. ... Updated input to C6
C6 =RecalcExample2 (C5 ) 2 Call to VB function
In this case Excel has updated the value of C6 . However, Excel has not detected the
dependency of
RecalcExample2() on C4 . The ... Declaring DLL functions in VB
Both functions and commands written in C/ C++ (or other languages where code is com-
piled to a Win32 DLL) can be accessed directly in VB using the
Declare statement
whose...
- 58
- 707
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 3 ppt
Ngày tải lên :
12/08/2014, 17:20
... check
in all the required places that this initialisation has occurred, using a global variable. A
satisfactory approach is to check in both
xlAddInManagerInfo and xlAutoAdd,and
to call
xlAutoOpen ... below.)
xlAutoClose
Note: If the user starts to close Excel, causing a call to xlAutoClose, but then cancels
when prompted to save their work, Excel does not then call any of the
xlAuto functions
to reinitialise ... the
File/Open command menu
or via
Tools /Add- ins , the Add -in Manager adds it to its list of known add- ins.
Warning:
In some versions of Excel, and in certain circumstances, the Add -in Manager
will...
- 58
- 378
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 5 ppt
Ngày tải lên :
12/08/2014, 17:20
... do not contain pointers to memory: they are
Accessing Excel Functionality Using the C API 231
Using the cpp_xloper class to call Excel, hiding the memory management, the original
code can be ... sections.
Accessing Excel Functionality Using the C API 249
Table 8.8 Macro sheet function
categories
Number Text
10 Commands
11 DDE/External
12 Customising
13 Macro Control
8.6.3 Specifying ... integer argument. Both of the
C API functions are covered in more detail later on in this chapter. In combination they
permit the function to get information about the calling cell(s) including...
- 58
- 406
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 6 docx
Ngày tải lên :
12/08/2014, 17:20
... worksheet and macro sheet functions.
Accessing Excel Functionality Using the C API 289
included in the example project in the source file BigData.cpp and are called in
the example worksheet
Binary_Name_Example.xls. ... xl_windows(int match_type, char *mask)
{
cpp_xloper Arg1(match_type, 1, 3);
cpp_xloper Arg2(mask);
Accessing Excel Functionality Using the C API 291
Callable from: Commands and macro sheet functions.
Return ... This can be more
Accessing Excel Functionality Using the C API 293
The Excel4() function set-up and call would be as shown in the following C/ C++
code. This is an example of an exportable function...
- 58
- 1.6K
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 9 pot
Ngày tải lên :
12/08/2014, 17:20
... with Excel)
Description Replaces all occurrences of characters in a search string with
corresponding characters from a replacement string, or removes all
such occurrences if no replacement string ... ways to use Excel’s own
functions to do the same thing, for example:
=IF(INT(A1)= 1 ,C1 ,IF(INT(A1)= 2 ,C2 ,IF(INT(A1)= 3 ,C3 ,# VALUE!)))
=CHOOSE(A1 ,C1 ,C2 ,C3 )
=INDEX (C1 :C3 ,A1)
Miscellaneous Topics ... Excel Add -in Development in C/ C++
// Excel 12+ interface function. Uses xloper12s and Unicode string
size_t __stdcall find_last_xl12(wchar_t *text, xloper12 *p_ch)
{
cpp_xloper Ch(p_ch);
wchar_t...
- 58
- 727
- 0
Financial Applications Using Excel Add-in Development in C/C++Second Edition phần 10 pptx
Ngày tải lên :
12/08/2014, 17:20
... Excel4v()
functions.
GetTime.cpp Code relating to getting the system time and system
clock.
InterfaceExample.cpp Examples of XLL interface functions.
Lookup.cpp Examples that extend the functionality of functions
such ... examples:
news://msnews.microsoft.com/microsoft.public.excel
news://msnews.microsoft.com/microsoft.public.excel.sdk
news://msnews.microsoft.com/microsoft.public.excel.programming
The Microsoft Developer Network ... 108–10, 423–9, 441
C# 3, 4, 8
C+ +
see also financial applications; Visual C+ +
504 Excel Add -in Development in C/ C++
Doing this leads to a very simple interface function when compared to one alternative...
- 64
- 490
- 0
Financial Applications using Excel Add-in Development in C/C++ phần 1 doc
Ngày tải lên :
14/08/2014, 02:20
... user-defined functions using COM 382
9.5.5 Calling XLM functions using COM 383
9.5.6 Calling worksheet functions using COM 383
9.6 Maintaining large data structures within the DLL 385
9.7 A C+ + Excel ... automation using
C+ + 376
9.5.1 Initialising and un-initialising COM 377
9.5.2 Getting Excel to recalculate worksheets using COM 379
9.5.3 Calling user-defined commands using COM 380
9.5.4 Calling ... functionality such
as the Solver add -in.
Add- ins come in two main flavours: interpreted macros and compiled code resources.
Version 4 of Excel introduced macro sheets which could contain macros written in...
- 59
- 307
- 0
Financial Applications using Excel Add-in Development in C/C++ phần 2 potx
Ngày tải lên :
14/08/2014, 02:20
... As Integer
CallCount1 = CallCount1 + 1
NumCalls
1 = CallCount1
End Function
Pressing {F9} will cause Excel to mark cell B3, containing the volatile function NOW(),
for recalculation (see section ... the inefficiency could be costly.
3
Using VBA
This chapter provides only a brief introduction to using VBA to create commands and
functions. It is not intended to be a detailed how -to guide to ... the
functions and commands they contain. Chapter 5 Turning DLLs into XLLs: The Add -in
Manager Interface, on page 111, describes the interface functions the add -in must provide
to enable Excel to...
- 59
- 397
- 0
Financial Applications using Excel Add-in Development in C/C++ phần 3 potx
Ngày tải lên :
14/08/2014, 02:20
... interface function calling
Action Functions called
User invokes Add -in Manager dialog for the
first time in this Excel session. The add -in was
loaded in previous session.
xlAddInManagerInfo
In the Add -in ... Excel with the add -in installed but
deactivated.
No calls made.
User closes Excel with the add -in installed and
activated.
xlAutoClose
xlAddInManagerInfo
User starts to close Excel but cancels ... whose
exported functions can be accessed via VB.
However, to create a DLL that can access Excel’s functionality or whose functions you
want to access directly from an Excel worksheet, you will need Excel’s...
- 59
- 251
- 0
Financial Applications using Excel Add-in Development in C/C++ phần 4 ppsx
Ngày tải lên :
14/08/2014, 02:20
... C/ C++ types. Many of these routines are
reproduced in the examples in section 6.9 below. Of particular importance is the Excel
C API function
xlCoerce. This function, accessed via the C API interface ... type, depending on how the function was registered), you should check your
function inputs and interpret them accordingly. Excel will coerce this type to zero if asked
to convert to a number, ... Excel Add -in Development in C/ C++
6.5 CONVERTING BETWEEN xloper/xloper12s
AND C/ C++ DATA TYPES
The need to convert arguments and return values can, in many cases, be avoided by declar-
ing functions...
- 59
- 265
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2