profile of a surface tolerance zone
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
Ngày tải lên :
22/02/2014, 02:20
... evaluation metrics cannot
be avoided, but ideally, a metric for the evaluation
of realisation rankers would rank alternative real-
isations in the same way as native speakers of the
language for ... Computational Linguistics
Human Evaluation of a German Surface Realisation Ranker
Aoife Cahill
Institut f¨ur Maschinelle Sprachverarbeitung (IMS)
University of Stuttgart
70174 Stuttgart, Germany
aoife.cahill@ims.uni-stuttgart.de
Martin ... inter alia ex-
act match, string edit distance, NIST SSA, BLEU,
NIST, ROUGE, generation string accuracy, gener-
ation tree accuracy, word accuracy (Bangalore et
al., 2000; Callaway, 2003; Nakanishi...
- 9
- 479
- 0
A PROFILE OF WOMEN’S HEALTH INDICATORS IN CANADA pptx
Ngày tải lên :
05/03/2014, 13:21
... in Canada,
Ottawa, October, 2002.
16
Health Canada,
Health Canada’s Gender-based Analysis Policy,
Ottawa, 2000, page 1.
17
Health Canada, Health Canada’s Women’s Health Strategy, Ottawa, ... Health Canada’s Gender-based Analysis Policy, Ottawa, 2000, page 3.
3
Health Canada,
Health Canada’s Gender-based Analysis Policy,
Ottawa, 2000, page 4.
4
Health Canada,
Health Canada’s Women’s ...
14
Statistics Canada,
Access to Health Care Services in Canada 2001,
catalogue no. 82-575-XIE, June, 2002, and
Statistics Canada, CANSIM II database.
15
Health Canada,
A Report on Mental Illnesses...
- 257
- 886
- 0
Strong reproductive barriers in a narrow hybrid zone of West-Mediterranean green toads (Bufo viridis subgroup) with Plio-Pleistocene divergence pptx
Ngày tải lên :
05/03/2014, 17:20
... of Lausanne,
CH-1015 Lausanne, Switzerland.
2
Dipartimento di Biologia Animale, University
of Palermo, Via Archirafi, 18, 90123 Palermo, Italy.
3
University of Catania,
CUTGANA, Section of Nature ... estimated hatching success, numbers of tadpoles at 7 day and two months after spawning, percentage of survival two
months after spawning, remarks and survival at day 40 after metamorphosis for each ... In each case, we choose a BioNJ as a
starting tree, and optimized top ology, branch length and
rate parameters. Other parameters were used as defaults
of the program. We generated bootstrap values...
- 16
- 429
- 0
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
Ngày tải lên :
08/03/2014, 23:20
... entire
protein has an on-rate that is two orders of magnitude faster
than for the Gla-domain presumably due to a further
stabilization of the structure of the Gla-domain, indicating
that less than 1% of the ... S.R., Talaga, P., Kamerling, J.P. & Vliegenthart, J.F.
(1999) Characterization of the carbohydrate binding specificity
and kinetic parameters of lectins by using surface plasmon
resonance. Anal. ... phase concentration of factor X (d), factor Xa
(m), DEGR-factor Xa (n), Gla–EGF
NC
(e), Gla–EGF
N
(r)andGla
(.). Solid lines indicate the least-square fit of the Langmuir model to
this data as...
- 6
- 401
- 0
A PROFILE OF DIETARY SUPPLEMENT USE OF ELDERLY IN TWO WISCONSIN COUNTIES pdf
Ngày tải lên :
14/03/2014, 17:20
... myocardial and
cerebral vascular accidents) is a major cause of hospitalization and death. (Timiras 1994,
199) Cancer, stroke, chronic obstructive pulmonary disease, influenza, and pneumonia
are ...
(Wellman et al 1997)
Another disabling disease of aging is Alzheimer’s and varying degrees of
dementia, which are also, frequent causes of hospitalization and death in the aging.
(Timiras 1994, ... using
aspirin ranged from an undetermined amount to 800 IU and a physician, again, was cited
as an information source. None of the subjects were taking coumadin and HM
Dosages of Alpha-Tocopherol,...
- 60
- 555
- 1
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot
Ngày tải lên :
17/03/2014, 09:20
... 2) complex in the absence of
catalase and the electrode was held at a negative potential
for 30 min to enable any oxidation products to accumulate
(as described in materials and methods), no such ... oxygenation reactions catalyzed by soluble
methane monooxygenase at the surface of a modified gold electrode
Yann Astier
1
*, Suki Balendra
2
, H. Allen O. Hill
1
, Thomas J. Smith
2†
and Howard Dalton
2
1
Chemistry ... SCE, saturated calomel electrode.
Enzymes: methane monooxygenase (EC 1.14.13.25).
Note: a web site is also available at http://www.bio.warwick.ac.uk/
dalton/
Note: Y. Astier and S. Balendra made...
- 6
- 464
- 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
Ngày tải lên :
23/03/2014, 04:21
... plasmid.
The gene was amplified from this plasmid by PCR using for-
ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT
CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-
TATACTATCCTCGAGCCACTGCATATCACGGATAC
GACGC-3¢. ... cDNA for cB using forward primer
5¢-ACTTATACTACT
CATATGGGGAAGATCACTTTTT
ACG-3¢ and reverse primer 5¢-ACTTATACTATC
CTCG
AGATAAAAATCCATCACCCG-3¢, and digested this with
restriction enzymes NdeI and ... laboratory.
References
1 Kapoor D, Kumar V, Chandrayan SK, Ahmed S, Shar-
ma S, Datt M, Singh B, Karthikeyan S & Guptasarma
P (2008) Replacement of the active surface of a thermo-
phile protein by that of a homologous...
- 13
- 430
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
Ngày tải lên :
23/03/2014, 13:20
... virion surface
Lyudmila A. Baratova
1
, Nataliya V. Fedorova
1
, Eugenie N. Dobrov
1
, Elena V. Lukashina
1
,
Andrey N. Kharlanov
2
, Vitaly V. Nasonov
3
, Marina V. Serebryakova
4
, Stanislav V. ... peptide. Monosaccharides were analyzed as AMC derivatives.
(A) Analysis of a blank sample ( eluate fraction between peaks in chromatograp hic profile shown in Fig. 3). (B) Analysis of a stan dard mixture
containing ... a stan dard mixture
containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc. (C) Analysis of peak 1 (Fig. 3A) . (D) A nalysis of peak 2 (Fig. 3A) .
3140 L. A. Baratova et al.(Eur. J. Biochem. 271)...
- 10
- 398
- 0
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc
Ngày tải lên :
23/03/2014, 17:20
... of automatic evalua-
tion methods for generation in terms of adequacy
and fluency on automatically generated English
paraphrases. They find that the automatic metrics
are reasonably good at measuring ... of the ACL-IJCNLP 2009 Conference Short Papers, pages 97–100,
Suntec, Singapore, 4 August 2009.
c
2009 ACL and AFNLP
Correlating Human and Automatic Evaluation of a German Surface
Realiser
Aoife ... a surface realisation
system, it is important to be able to quickly and au-
tomatically evaluate its performance. The evalua-
tion of a string realisation system usually involves
string comparisons...
- 4
- 285
- 0
A Profile of Women’s Health in the United States ppt
Ngày tải lên :
28/03/2014, 12:20
... disease N /A N /A N /A N /A N /A N /A N /A N /A N /A 81.2 N /A 31.0
Anemias N /A 1.2 N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A
*Persons of Hispanic origin may be of any race.
**Data available for 10 leading ... 4.2 N /A N /A N /A
Congenital 1.0 1.4 — N /A N /A N /A N /A N /A N /A N /A N /A N /A
anomalies
Complications of N /A 1.2 — N /A N /A N /A N /A N /A N /A N /A N /A N /A
pregnancy, childbirth,
and puerpium
Alzheimer’s ... 10 leading causes of death in each age-race/ethnicity group; data are not available for Asian/Pacific Islander or Native American women.
N /A: the cause is not a leading cause in that group.
—Figure...
- 236
- 1.1K
- 0
2012 Small Business Profile - A profile of small business in British Columbia pot
Ngày tải lên :
29/03/2014, 19:20
... 15%
Northeast
North Coast & Nechako
Cariboo
Kootenay
Thompson-Okanagan
Mainland/Southwest
Vancouver Island/Coast
0.6% =
Provincial
average
Small Business Profile | 2012 page 19
FIGURE 3.3
AvERAGE ... United States. Asia has
been the principal market for growth of B.C.’s exports,
particularly China. With British Columbia positioned as
Canada’s gateway to the Asia Pacific, both small and large ... earned
an annual salary of $38,811, compared to $46,594
for employees of large business, which amounts to a
difference of about $7,800. It is likely that at least part of
this wage gap is related...
- 36
- 248
- 0
improving near field confinement of a bowtie aperture using surface plasmon polaritons
Ngày tải lên :
06/05/2014, 08:53
... 2
phase modulation
when the wave propagates to and reflects from the groove.
A close examination of Fig. 2͑b͒ indicates that SPP
waves are excited at the edges of each groove and stronger
fields are ... produce standing waves
matching the SPP wavelength. Superposition of these stand-
ing waves and the emerging field at the slit leads to a nar-
rower field. When changing the film and media materials, ... bowtie aperture and another surface is not desirable.
The authors gratefully acknowledge the support of the
National Science Foundation ͑Grant No. DMI-0707817͒, the
Defense Advanced Research Projects...
- 3
- 347
- 0
báo cáo hóa học:" Validation of a Greek version of the Oral Health Impact Profile (OHIP-14) for use among adults" pdf
Ngày tải lên :
20/06/2014, 16:20
... sponsored by a Colgate Palmolive Company grant.
1
Validation of a Greek version of the Oral Health Impact Profile (OHIP-14)
for use among adults
Vassilia Papagiannopoulou
1
, Constantine J Oulis ... discriminant validity was evaluated by
examining the association between the OHIP-14 total score and participants’ dental
status as assessed by the clinical examination. Mann-Whitney or Kruskal-Wallis ... Theodorou M, Mastrogiannakis T, Mamai-Chomata E,
Polychronopoulou A, Athanasouli T: Oral health status and treatment
needs of the Hellenic population -a pathfinder survey-proposals for
improvement....
- 30
- 235
- 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
Ngày tải lên :
20/06/2014, 20:20
... Lin H, Bansil A, Grauer D, Hor YS, Cava RJ, Hasan
MZ: Observation of a large-gap topological-insulator class with a single Dirac cone
on the surface. Nat Phys 2009, 5:398
[12] Chen YL, Analytis ... Qian D, Wray L, Xia Y, Hor YS, Cava RJ, Hasan MZ: A topological Dirac
insulator in a quantum spin hall phase. Nature 2008, 452:970
[10] Hsieh D, Xia Y, Wray L, Qian D, Pal A, Dil JH, Osterwalder ... topological insulators have robust and
simple surface states consisting of a single Dirac cone at the Γ point [8]. Note that this
Hamiltonian appears similar to graphene [13], but topological insulators...
- 18
- 404
- 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
Ngày tải lên :
20/06/2014, 22:20
... Onufrijevs and Alexander Mychko
Abstract
On the basis of the analysis of experimental results, a two-stage mechanism of nanocones formation on the
irradiated surface of semiconductors by Nd:YAG laser ... in nanocone is a special case, since
diameter of nanocone is a monotonous function of
height, leading to gradual change of bandgap. Graded
bandga p structure has an effect on properties of particles
and ... surface
of Si like a thin film. As a result, LRA stage gradually tran-
sits to SLA stage.
The second stage, SLA, is characterized by formation of
nanocones on the irradiated surface of a semiconductor
by...
- 6
- 489
- 0
![Báo cáo y học: "Behavioral and antioxidant activity of a tosylbenz[g]indolamine derivative. A proposed better profile for a potential antipsychotic agent" pptx](https://media.store123doc.com/images/document/2014_08/09/medium_srr1407504202.jpg)