process evaluation of a nursing support intervention with rural african american mothers with preterm infants
Explaining the effects of an intervention designed to promote evidence-based diabetes care: a theory-based process evaluation of a pragmatic cluster randomised controlled trial pot
Ngày tải lên :
11/08/2014, 05:21
... final draft Additional material Additional file DREAM PE Final Questionnaire This questionnaire is the theory-based instrument that was used to collect the data for the DREAM process evaluation ... over these behaviours Group differences in TPB variables: Multiple analyses of variance (MANOVAs) To identify factors affecting the mean values of the TPB variables, a series of MANOVAs were conducted ... had a number of limitations First, although the non-response analysis indicated that the sample was representative in all but one of the measured variables (number of years since professional...
- 11
- 356
- 0
báo cáo khoa học: " Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workers" pdf
Ngày tải lên :
10/08/2014, 10:23
... higher management of all companies agreed with the financial and organisational consequences of the intervention Based on their main workload, participating departments were classified into: mental, ... physical, mix mental/physical, or heavy physical departments [31] Within each company, one randomisation pair of two departments with comparable workloads was randomly allocated to either the intervention ... decision authority, a maximum of eight workers who were a solid representation of the largest and most important task groups at the department If available, an occupational health and safety coordinator...
- 11
- 291
- 0
Báo cáo y học: " What work has to be done to implement collaborative care for depression? Process evaluation of a trial utilizing the Normalization Process Model" doc
Ngày tải lên :
11/08/2014, 05:21
... http://www.maxqda.com/ 25 Department of Health: Graduate Primary Care Mental Health Workers: Best3 Practice Guidance London: Department of Health 2003 26 Richards DA, Hughes-Morley A, Hayes RA, Araya R, Barkham ... identical to this.’ (case manager/graduate mental health worker, after trial) But others, as we have indicated, questioned some aspects of the protocol as a valid way of interacting with patients, ... implementation of collaborative care for depression in both research trials and routine practice It provided a novel way of evaluating and interpreting process data that added value to the analysis...
- 11
- 434
- 0
báo cáo khoa học: " What work has to be done to implement collaborative care for depression? Process evaluation of a trial utilizing the Normalization Process Model" potx
Ngày tải lên :
11/08/2014, 16:20
... http://www.maxqda.com/ 25 Department of Health: Graduate Primary Care Mental Health Workers: Best3 Practice Guidance London: Department of Health 2003 26 Richards DA, Hughes-Morley A, Hayes RA, Araya R, Barkham ... identical to this.’ (case manager/graduate mental health worker, after trial) But others, as we have indicated, questioned some aspects of the protocol as a valid way of interacting with patients, ... implementation of collaborative care for depression in both research trials and routine practice It provided a novel way of evaluating and interpreting process data that added value to the analysis...
- 11
- 350
- 0
báo cáo sinh học:" Improving pneumonia case-management in Benin: a randomized trial of a multi-faceted intervention to support health worker adherence to Integrated Management of Childhood Illness guidelines" doc
Ngày tải lên :
18/06/2014, 17:20
... In particular, we thank Loukmane Agbo-Ola and Paul Kple-Faget for their support of our research activities, François Cokou for his assistance with data management and Samantha Rowe for her gracious ... Brazil found that caseload was inversely associated with consultation time, with the association being strongest at caseloads over 50 per day, and that quality of care was highest in the areas ... Correct diagnosis, which was excluded from the multivariate analysis because it was considered a causal pathway variable, was strongly associated with recommended treatment (Table 2, last row)...
- 13
- 512
- 0
báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot
Ngày tải lên :
20/06/2014, 08:20
... used at the end of each activity Ongoing evaluation None: evaluation at end of training Daily evaluation with answers provided Materials Training manual only Trainers’ manual & participant’s handout ... phase of MEMA kwa Vijana (MkV2), which was a collaboration between the Tanzanian National Institute for Medical Research, the African Medical and Research Foundation, the ministries of Health and ... Rationale and design of the MEMA kwa Vijana adolescent sexual and reproductive health intervention in Mwanza Region, Tanzania AIDS Care 2006, 18(4):311-322 21 Ross DA, Changalucha J, Obasi AI,...
- 12
- 370
- 0
Báo cáo hóa học: " Pharmacokinetic evaluation of a 1,3-dicyclohexylurea nanosuspension formulation to support early efficacy assessment" docx
Ngày tải lên :
22/06/2014, 18:20
... implanted with BASi vascular catheters (West Lafayette, IN) in the carotid artery and jugular vein Animals were acclimated in Culex cages (BASi) overnight prior to dosing Patency of the carotid artery ... sEH by DCU leads to an increase in epoxyeicosatrienoic acids (EETs) EETs are P450-derived metabolites of arachidonic acid and are well established regulators of cardiovascular and renal function ... used a copper X-ray source maintained at 40 kV and 40 mA to provide radiation with an intensity weighted ˚ average of (Kaave) 1.54184 A A scintillation counter was ¨ used for detection A Gobel...
- 6
- 336
- 0
báo cáo khoa học: "Process evaluation of appreciative inquiry to translate pain management evidence into pediatric nursing practice" ppt
Ngày tải lên :
10/08/2014, 10:23
... was viewed as a practical and realistic way to approach change Overall, participants noted that expanding on existing practices eased and supported their implementation of the action plan as an ... other interventionists to assume an AI approach AI was considered a clinically useful intervention because it was applicable to other areas besides pain It was characterized as a refreshing approach ... of organisational changes [35] Adaptability is essential to sustainability [35], and the AI process may have particular benefit in this regard, as it builds on what exists and participants can...
- 13
- 281
- 0
báo cáo khoa học: " Usability evaluation of a clinical decision support tool for osteoporosis disease management" pps
Ngày tải lên :
10/08/2014, 10:23
... combination of qualitative analysis to assess the effect of technology on participant reasoning and decision-making, and quantitative analysis to assess data from the demographic questionnaire, ... were audiotaped and transcribed verbatim Usability study was also videotaped to observe users’ physical behaviour as they interacted with the RAQ Data collection and analysis consisted of a combination ... moderator also asked participants to rate the readability, understandability, and format of the COPE sheet using a verbal five-point Likert scale Data collection and analysis All usability sessions...
- 12
- 362
- 0
báo cáo khoa học: " Evaluation of a clinical decision support tool for osteoporosis disease management: protocol for an interrupted time series design" ppt
Ngày tải lên :
10/08/2014, 11:20
... osteoporosis risk management strategies Trials 2008, 9(1):62 39 Public Health Agency of Canada Canada’s Aging Population: Who are Canada’s Seniors? Division of Aging and Seniors, Health Canada 2002; [http://www.phac-aspc.gc.ca/seniors-aines/publications/public/various-varies/ ... University of Toronto, Toronto, Ontario, Canada 3Dalla Lana School of Public Health, University of Toronto, Toronto, Ontario, Canada 4Department of Mechanical and Industrial Engineering, University of ... constant comparative approach will be used to group the codes into categories and identify themes Quantitative analysis of accompanying questionnaire data will be analyzed using analysis of variance...
- 7
- 436
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
Ngày tải lên :
10/08/2014, 11:20
... Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will be two-sided and performed at significance ... initial effects V Analyze pilot study data and prepare manuscripts and future grant proposals CAB = community advisory board; PCARE = primary care, access referral and evaluation 1-3 Cabassa et al ... language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface adaptations...
- 12
- 423
- 0
báo cáo khoa học: " Rational Prescribing in Primary care (RaPP): process evaluation of an intervention to improve prescribing of antihypertensive and cholesterol-lowering drugs" ppsx
Ngày tải lên :
11/08/2014, 05:22
... reminders about treatment goals and of assessing cardiovascular risk A majority also stated that they usually assessed the cardiovascular risk and that they believed most of their patients achieved recommended ... impact on other outcomes The data we collected Table 6: Multivariate regression model: Rate of cardiovascular risk assessment Dependant variable: Rate of assessment of cardiovascular risk Explanatory ... variable Dependant variable Change in rate of thiazideprescribing Geographical area (Oslo- or Tromsø-area) Size of practice (number of doctors) Proportion of doctors present at meeting Pharmacist...
- 9
- 177
- 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx
Ngày tải lên :
11/08/2014, 15:22
... evaluation A process analysis will be carried out to determine the actual use of the components of the psychosocial, psychological and pharmacological treatment, and to determine facilitators and ... American Geriatrics Society & American Association for Geriatric Psychiatry: Consensus statement on improving the quality of mental health care in US nursing homes: management of depression and ... and behavioral management strategy should be incorporated in regular care The psychologist supervises the recreational therapist and nursing staff in at least regular staff meetings Additionally,...
- 7
- 484
- 0
Báo cáo y học: "Over-expression of glutamine synthase in focal nodular hyperplasia (part 1): Early stages in the formation support the hypothesis of a focal hyper-arterialisation with venous (portal and hepatic) and biliary damage" pps
Ngày tải lên :
13/08/2014, 13:20
... the pathogenesis of focal nodular hyperplasia of the liver Hepatology 1985, 5:1194-1200 Bioulac-Sage P, Balabaud C, Wanless IR: Diagnosis of focal nodular hyperplasia: not so easy Am J Surg Pathol ... prime cause of FNH may be arterial, due to the lack of branches to various tributaries (portal, hepatic veins and ducts) This lack of branches may lead to conditions that are either primary (malformative ... (malformative focal arterial disease) or secondary to inflammation (as suggested by an increased number of inflammatory cells in portal tracts); this in turn leads to the disappearance of portal vein,...
- 28
- 230
- 0
Thermal comfort and indoor air quality evaluation of a ceiling mounted personalized ventilation system integrated with an ambient mixing ventilation system
Ngày tải lên :
14/09/2015, 08:37
... which shares 40% land surface of the earth The characteristics of tropical climate are abundant rainfall and high humidity associated with a low diurnal temperature range and relatively high air ... Zukowska Daria, Schiavon Stefano, Haneda Masaoki and Simonsen Peter Slotved The financial supports from National University of Singapore, ASHRAE graduate Grant-in-aid (2007) and Chinese Government Award ... conservation can be achieved without affecting thermal comfort and inhaled air quality The disadvantage is that fan energy for air transportation increases because of several extended PV air ducts A number...
- 300
- 254
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
Ngày tải lên :
05/09/2013, 16:11
... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... Cape Verde was used for soap production and for lamps Jatropha is a small tree or large shrub, which can reach a height of three to five meters, but under favorable conditions it can attain a...
- 12
- 568
- 0
Thermal evaluation of a sun tracking solar cooker
Ngày tải lên :
05/09/2013, 17:03
... double-glazed solar cooker, Kumar [7] One of the earliest mathematical models to test the thermal performance of a Solar Cooker was presented by Garg et al [8] and Vaishya et al [9] Also, Jubran and Alsaad ... solar cooker, and the parameters that characterize the performance of the solar cooker Evaluation of solar cooker thermal performance using different insulating materials was conducted by Mishra ... and management vol 32 (6): pp 537-541 R S Mishra, S P Prakash, 1984, Evaluation of solar cooker thermal performance using different insulating materials, International Journal of Energy Research...
- 8
- 423
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
Ngày tải lên :
16/01/2014, 21:20
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors...
- 8
- 492
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
Ngày tải lên :
18/02/2014, 14:20
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0