precomputing arithmetic expressions with a function based index
Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx
... instantiated A free variable is instantiated as follows: each free variable labels a syntactic node variable and is unied with the label of any node variable identied with For the purpose of this paper, ... is a model in which each negaS tive node variable is identied with exactly one positive node variable, each positive node variable with exactly one negative node variable and neutral node variables ... neutral node variable is a variable that may not be identied with any other node variable Formally, polarities are used to dene the class of saturated modfor a tree description els A saturated model...
- 8
- 397
- 0
Báo cáo khoa học: "Chinese Segmentation with a Word-Based Perceptron Algorithm" docx
... bigram w1 w2 single-character word w a word starting with character c and having length l a word ending with character c and having length l space-separated characters c1 and c2 character bigram ... each candidate in the source agenda and puts the generated candidates onto the target agenda After each character is processed, the items in the target agenda are copied to the source agenda, ... source agenda, and then the target agenda is cleaned, so that the newly generated candidates can be combined with the next incoming character to generate new candidates After the last character is...
- 8
- 380
- 0
Báo cáo khoa học: "LEARNING TRANSLATION SKILLS WITH A KNOWLEDGE-BASED FRENCH-ITALIAN CONJUNCTIONS IN CONTEXT" pdf
... languages E L I S A : A RATHER INTELLIGENT TUTOR OF FOREIGN LANGUAGE WORDS A The Purpose of ELISA ELISA teaches a student to disambiguate conjunctions in a foreign language by means of a dialogue ... available in the field of Foreign Language Teaching and usable on a large scale for Computer Assisted Learning II The Presentation P h a s e Notice that "concepts" are defined pragmatically i.e ... a proof of the potential power of AI representations in educational settings and in projects of natural language translation Practically, our program is one of the few Intelligent Systems available...
- 6
- 349
- 0
Báo cáo khoa học: "Generating referring expressions with a unification grammar" doc
... 1989 Paragraphs and anaphora Journal of Pragmatics, 13:239 250 H Horacek 1997 An algorithm for generating referential descriptions with flexible interfaces In 35th Annual Meeting of the Association ... where a 'style' embraces preferences regarding textual organization, wording, punctuation and layout To cover a large range of styles, many patterns must be made available to the generator, even ... p FA FB MA Ms 0/0 Final context SA SB p 0 MA M B 1/1 where FA, MA, etc are variables Among other things this rule implies that 'a patch' may be used whatever the current focus values for SA and...
- 6
- 227
- 0
Báo cáo y học: "The association between weight loss and engagement with a web-based food and exercise diary in a commercial weight loss programme: a retrospective analysis" pdf
... dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated with percentage ... acknowledged Authors’ contributions FJ planned the analysis strategy, analyzed the data and drafted the article in collaboration at all stages with JW Both authors read and approved the final manuscript ... unbranded food items, automatically calculating an estimate of calorie intake A daily exercise diary encourages additional physical activity by setting a target to expend a minimum of an extra...
- 7
- 284
- 0
Báo cáo y học: "The validity of a rheumatoid arthritis medical records-based index of severity compared with the DAS28" docx
... functional status (arthritis flares, morning stiffness, physician global rating, and functional status), and extra-articular manifestations (vasculitis and pulmonary nodule) These indicators are available ... were assumed to be the absence of the extra-articular manifestation for pulmonary nodule When radiologic and laboratory data were not available, the data was considered as missing ACR, American ... through a physician's assessment A measure of RA functional status based on American College of Rheumatology standards [26] involves clinical assessment (for example, physical examination), laboratory...
- 7
- 365
- 0
Báo cáo y học: "The validity of a rheumatoid arthritis medical records-based index of severity compared with the DAS28" pdf
... clinical status (joint counts and global health) and acute phase reactants [4] Disease activity is associated with radiographic damage [5] and with surgery [6], both components of the RARBIS Acute ... Arthritis Research & Therapy Vol No Landewé and van der Heijde Feasibility, finally, pertains to the ease with which the RARBIS can be elicited and calculated in practice Time and costs are ... activity in an index intended to assess severity The RARBIS does not improve conceptually by such a statistical effort Only substantial — and not statistical — arguments that favour an increased weight...
- 2
- 263
- 0
A three phase voltage type PWM rectifier with the function of an active power filter
... rectifier with active filtering function" , IEEJ SPC- 96 (107), 11-20 ( in Japanese) KataokaT, Murota 1, Fuse Y, Nakajima D and Nishikata S 1999, A Single-phase Voltage-Type P W Rectifier with the Function ... sinusoidal waveform in compliance with the sinusoidal reference signal and , that the current i has a nearly rectangular waveform due to the existence of a smoothing reactor Fig3(b) shows the waveform ... forphase v which is given by (11) can also be obtained in the same manner as that explained above for phase U EXPERIMENTAL INVESTIGATION To confirm the operation of the three-phase PWM rectifier with...
- 6
- 479
- 1
Tài liệu Báo cáo khoa học: A knowledge-based potential function predicts the specificity and relative binding energy of RNA-binding proteins ppt
... 281–299 Case DA, Darden TA, Cheatham TE III, Simmerling CL, Wang J, Duke RE, Luo R, Merz KM, Wang B, Pearlman DA et al (2004) Amber8 University of California, San Francisco, CA Izaguirre JA, Catarello ... discrimination We anticipate that the performance of the potential will only increase with the size of the structural database and as terms are added to the model to account for protein and RNA intra-molecular ... potential, the average Z-score was approximately half that obtained with the protein–RNA potential ()2.84 versus )5.45; see also supplementary Table S4) Thus, although the chemistry of RNA and DNA are...
- 14
- 736
- 0
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot
... dull-white At the end of this stage the first spermatozoa appear in testis SG is dull-white Gonad is large, opaque and appear granular Oocytes are at intercalary and protoplasmic growth phase AG are ... Octopoteuthis sicula, Sepia bertheloti and Abraliopsis atlantica In Argonauta argo and Pteriqioteutnis gemmata, at the stage when the simple follicle nucleoli start decomposing, they acquire a characteristic ... epipelagic species Tremoetopus vio/aeeus, as well as those of midwater species of Bolitanidae and Amphitretidae families, bear eggs in their arms, similar to bottom dwelling Hapa/oeh/aena maeu/osa...
- 12
- 623
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... of advantages over expectations from market economists: unlike survey -based expectations, they are again available at any time and for any tenor, and they reflect the agglomerated knowledge of all ... References Australian Financial Markets Association 2008 Australian Financial Markets Report Beechey, M 2008 “Lowering the Anchor: How the Bank of England’s Inflation-Targeting Policies Have Shaped Inflation ... The parameters ατ and β τ (and Ωs−t ) are defined in appendix 2, ¯ ∗ and are similar to ατ and β ∗ from equation (5) τ 3.1 Data and Model Implementation Data Four types of data are used: nominal...
- 32
- 347
- 0
Báo cáo khoa học: "A SNoW based Supertagger with Application to NP Chunking" ppt
... IOB tag We first use the fast TBL (Ngai and Florian, 2001), a Transformation Based Learning algorithm, to repeat Ramshaw and Marcus’ experiment, and then apply the same program to our new dataset ... via pairwise voting as in (van Halteren et al., 1998; Chen et al., 1999) as the final supertag This approach of voting also helps to cope with the label bias problem tag set auto auto hand hand ... trained with a trigram model Although supertags are able to encode long distance dependence, supertaggers trained with local information in fact not take full advantage of their strong capability...
- 8
- 292
- 0
Báo cáo khoa học: "From Chunks to Function-Argument Structure: A Similarity-Based Approach" doc
... speech data The fragmentary and partially illformed nature of such spoken data makes them harder to analyze than written data such as the Penn treebank typically used as gold standard It should also ... treebank uses a total of 13 functional labels, while the German treebank has a richer set of 36 function labels The evaluation consisted of a ten-fold crossvalidation test, where the training data ... paradigm is an instance of lazy learning in the sense that these previously encountered instances are stored “as is” and are crucially not abstracted over, as is typically the case in rule-based...
- 8
- 308
- 0
Báo cáo khoa học: "Lexicon acquisition with a large-coverage unification-based grammar" pot
... the status of the features Barg and Walther (1998) talk about generalisable and revisable information The former are values that are too specific (e.g case), while the latter are values that should ... not with a grammar of a similar coverage We have described a way how the information concerning unknown words can be restricted in a grammatically sound way, by the definition of lexical types and ... — and can therefore be realised by a type — the fact that it is a plural will restrict it further Evaluation There are two aspects that are relevant to be measured: the quality of the newly acquired...
- 4
- 251
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Office: rbainfo@rba.gov.au Abstract We estimate inflation ... Model-derived inflation expectations also have a number of advantages over expectations from market economists: unlike survey -based expectations they are again available at any time and for any tenor; and ... inflation expectations and inflation risk premia Due to a lack of data we cannot this and instead estimate inflation forward rates as part of our model 18 inflation, a low 2-year break-even inflation...
- 39
- 395
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation ... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and flow ... and with a GAPDH probe (cf Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed...
- 8
- 331
- 0
Báo cáo khoa học: "A Rote Extractor with Edit Distance-based Generalisation and Multi-corpora Precision Calculation" doc
... 1996 Automatically generating extraction patterns from untagged text In AAAI M Ruiz-Casado, E Alfonseca, and P Castells in press Automatising the learning of lexical patterns: an application ... extraction patterns from partially annotated and unannotated data (Huffman, 1995; Riloff, 1996; Riloff and Schmelzenbach, 1998; Soderland, 1999) Generalizing textual patterns (both manually and automatically) ... training corpora, again using Google The chosen entities are Robert de Niro and Natalie Wood (actors), Isaac Asimov and Alfred Bester (writers), Montevideo and Yaounde (capitals), Gloria Macapagal...
- 8
- 289
- 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... AS-15 TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ... GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelated GFP–CDS ... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢...
- 10
- 432
- 0
a literature based intervention for older people living with dementia
... about the sea As a child she lived in Flint in Wales, but always visited Talacra on the coast and has clear memories of it Eventually her father built a bungalow at Talacra and she recalls many ... that steals lives and tears at the hearts of families, but that relative to its impact is hardly acknowledged Dementia is simply a terrible disease And it is a scandal that we as a country haven’t ... much favoured activity being karaoke The reading group takes place in a designated part of the main room and gathers about to 10 participants each week, with both males and females participating...
- 40
- 508
- 0
- obesity is associated with a high prevalence of erectile dysfunction; however
- with a little help
- service with a smile
- a program with a gui
- a room with a view
- a perception based model
- come with a full discursive
- performing batch updates with a dataadapter
- using a transaction with a dataadapter
- adding records with a guid primary key
- updating a dataset with a manytomany relationship
- using transactions with a dataset sql
- leave with a career
- do not separate two predicates with a comma unless the comma has a valid function
- using form based authentication with a jsp page
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008