pracice 1 practice the dialogue with a partner
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
Ngày tải lên :
20/06/2014, 01:20
... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E coli DH10B strain ... (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3') for UL8; and 18 S rRNA-f (5'-actcaacacgggaaacctca-3') ... fragment containing a UL7 ORF amplified from the HSV -1 genome by PCR into pBluescript II KS+ (Stratagene) 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3'...
- 13
- 463
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt
Ngày tải lên :
06/07/2014, 20:20
... >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: A dilated, superficial blood vessel ... focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary, while the correct ... interpretation would be that the patient has a pruritic eczematous dermatitis with erosions caused by scratching Figure 52 -1 Superficial spreading melanoma This is the most common type of melanoma Such...
- 5
- 413
- 0
Tài liệu TNXH 1 - BÀI 1: CƠ THỂ CHÚNG TA A. Mục tiêu: -Kiến thức : Kể tên các bộ phận chính của docx
Ngày tải lên :
21/01/2014, 10:20
... động 1: Quan sát tranh *Mục tiêu:Gọi tên phận bên thể *Cách tiến hành: -HS làm việc theo hướng dẫn GV Bước 1: HS hoạt động theo cặp -GV hướng dẫn học sinh:Hãy nói tên -Đại diện nhóm lên bảng v a phận ... quan sát thảo luận phận bên thể gồm ba phần chính:đầu, mình,tay chân *Cách tiến hành: Bước 1: Làm việc theo nhóm nhỏ -GV nêu: -Đại diện nhóm lên biểu diễn lại hoạt động bạn tranh HS nhắc lại Quan ... hành: Bước1: -GV hướng dẫn học hát: Cúi mỏi lưng Viết mỏi tay Thể dục Là hết mệt mỏi Bước 2: GV v a làm mẫu v a hát Bước 3:Goi HS lên thực để lớp làm theo -Cả lớp v a tập thể dục v a hát *Kết...
- 5
- 978
- 0
The World with a Thousand Moons pdf
Ngày tải lên :
06/03/2014, 00:20
... elements He made up this formula, and tried it on a gravitation-paralysis case a space-man who's lain paralyzed for years The formula was designed to strengthen the human nervous system against the shock ... escort of armed pirates guarding them, and Dark and Holk Or ahead, they started through the jungle toward the pirate camp 38 Chapter Asteroid Horror T he pirate encampment was a big clearing hacked ... standing tense, had had an idea A desperate chance to make a break, in the face of Murdock's atom-gun The captain had said that he had just ordered the pilot to slow down the Sunsprite In a moment...
- 52
- 408
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
Ngày tải lên :
16/03/2014, 12:20
... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC ... Phe554 fi Ala, Asn555 fi Ala, Glu667 fi Ala, Phe692 fi Ala, Phe700 fi Ala, Phe 718 fi Ala, Phe692 fi Ala ⁄ Phe 718 fi Ala and Val736 fi Ala, were included in an appropriate mammalian expression vector and then...
- 15
- 337
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot
Ngày tải lên :
23/03/2014, 04:20
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... men and measures, perhaps with a more sustained hand on account of the share her son was Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 15 then ... LETTERS Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 18 OF JOHN ADAMS AND HIS WIFE JOHN ADAMS Boston, 12 May, 17 74 I am extremely afflicted with...
- 269
- 350
- 0
the hero with a thousand faces commemorative edition vol 17 joseph campbell
Ngày tải lên :
08/06/2014, 09:03
... Geza Roheim's translation of an Australian Aranda term, altjiranga mitjina, which refers to the mythical ancestors who wandered on the earth in the time called altjiranga nakala, "ancestor was." ... CHAPTE R II: Initiation 89 The Road of Trials 89 The Meeting with the Goddess 10 0 Woman as the Temptress 11 1 CONTENTS CONTENTS Atonement with the Father 11 6 Apotheosis 13 8 The Ultimate Boon 15 9 ... that in the main the mental characteristics of man are the same all over the world" (The Mind of Primitive Man, p 10 4 Copyright, 19 11 by The Macmulan Company and used with their permission) "Bastian...
- 297
- 614
- 0
how to practice the way to a meaningful life dalai lama
Ngày tải lên :
04/07/2014, 15:49
... Holiness the Dalai Lama teach in 19 72 Just three days after my arrival in Dharamsala in northern India he started a sixteen-day lecture series for four to six hours each day on the stages of the path ... that action (virtuous or not) serves as a path, or a means, to a complete lifetime in either a happy transmigration or a bad transmigration To be a “path of action,” a karma must have four characteristics: ... Lhasa advised me that the situation looked workable and that I should return While on the way back to Lhasa, we spent several days at the Regent’s monastery, Talungdra One day he asked during a...
- 103
- 557
- 1
annual report 2001 the bank with a human face ANZ
Ngày tải lên :
04/07/2014, 22:17
... 22,5 01 23 ,13 4 30 ,17 1 32,072 36,830 39,7 21 39,240 39,642 40,277 43,977 18 1,035 17 9,244 214 ,15 1 15 1,564 13 2,450 12 1,847 11 4,829 12 1,070 11 5,000 11 2,036 Data for 19 98, 19 99, 2000 and 20 01 includes the ... (69) 1, 1 71 (14 7) 1, 116 – 1, 033 19 803 19 460 ( 213 ) (578) (1) Profit (loss) after tax 1, 870 1, 747 1, 480 1, 106 1, 024 1, 116 1, 052 822 247 (579) Statement of Financial Position Assets 1, 294 1, 218 (637) ... Philippines, Singapore, Taiwan, Thailand and Vietnam Pacific American Samoa, Cook Islands, East Timor, Fiji, Papua New Guinea, Samoa, Solomon Islands, Tonga and Vanuatu Ian Richards Head of Strategy Future...
- 35
- 339
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx
Ngày tải lên :
06/07/2014, 20:20
... epidermal atrophy) Scar: A change in the skin secondary to trauma or inflammation Sites may be erythematous, hypopigmented, or hyperpigmented depending on their age or character Sites on hair-bearing ... associated with xerosis and aged skin Systemic conditions that can be associated with pruritus include chronic renal disease, cholestasis, pregnancy, malignancy, thyroid disease, polycythemia vera, and ... hair-bearing areas may be characterized by destruction of hair follicles Table 52-3 Common Dermatologic Terms Alopecia: Hair loss; it may be partial or complete Annular: Ring-shaped lesions Cyst: A soft,...
- 5
- 334
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc
Ngày tải lên :
06/07/2014, 20:20
... lesions, the shape of individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous membranes of the mouth, ... lesions and make it possible to assess the distribution of the eruption accurately The patient should first be viewed from a distance of about 1. 5–2 m (4–6 ft) so that the general character of the ... erythematous exanthem is more likely to have a drug eruption than is a patient with a similar rash limited to the sun-exposed portions of the face Once the distribution of the lesions has been established,...
- 5
- 414
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx
Ngày tải lên :
06/07/2014, 20:20
... A D The distribution of some common dermatologic diseases and lesions Figure 52-7 Psoriasis This papulosquamous skin disease is characterized by small and large erythematous papules and plaques ... skin disease is characterized by small and large erythematous papules and plaques with overlying adherent silvery scale Figure 52-8 ...
- 5
- 321
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf
Ngày tải lên :
06/07/2014, 20:20
... contact (Fig 52 -10 ) or primary irritant dermatitis In contrast, lesions with a generalized arrangement are common and suggest a systemic etiology Figure 52-9 Erythema multiforme This ... This eruption is characterized by multiple erythematous plaques with a target or iris morphology It usually represents a hypersensitivity reaction to drugs (e.g., sulfonylamides) or infections ... (e.g., sulfonylamides) or infections (e.g., HSV) (Courtesy of the Yale Resident's Slide Collection; with permission.) Figure 52 -10 ...
- 5
- 319
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt
Ngày tải lên :
06/07/2014, 20:20
... psoriasis, or acne) 10 Social, sexual, or travel history as relevant to the patient DIAGNOSTIC TECHNIQUES Many skin diseases can be diagnosed on gross clinical appearance, but sometimes relatively ... or saucerized with a scalpel or removed by punch biopsy In the latter technique, a punch is pressed against the surface of the skin and rotated with downward pressure until it penetrates to the ... superficial anatomic structures in selected areas of the body In this procedure, a small area of skin is anesthetized with 1% lidocaine with or without epinephrine The skin lesion in question can be...
- 5
- 398
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx
Ngày tải lên :
06/07/2014, 20:20
... noting the amount of blanching that occurs Granulomas often have an opaque to transparent, brown-pink "apple jelly" appearance on diascopy Figure 52 -11 Urticaria Discrete and confluent, edematous, ... edematous, erythematous papules and plaques are characteristic of this whealing eruption Wood's Light A Wood's lamp generates 360-nm ultraviolet (or "black") light that can be used to aid the evaluation ... Wood's lamp, and previously unsuspected areas of involvement often become apparent A Wood's lamp may also aid in the demonstration of tinea versicolor and in recognition of ash leaf spots in patients...
- 5
- 367
- 0
Báo cáo khoa học: "Highly malignant soft tissue sarcoma of the extremity with a delayed diagnosis" ppsx
Ngày tải lên :
09/08/2014, 03:22
... and ankle joint (three cases), the forearm (four cases), and the popliteal area (one case) Pulmonary metastasis was detected at diagnosis in all alveolar soft part sarcoma cases and in one clear ... one case of synovial sarcoma (Figure 1) and one case of alveolar soft part sarcoma showed calcification on plain radiographs In all three cases of alveolar soft part Figure A plain radiograph ... MRI images of an alveolar soft part sarcoma (A) An axial T1-weighted fat-suppressed image and (B) an axial T2-weighted image High signal on T1FS, T2WI with multiple signal voids are apparent...
- 5
- 286
- 0
báo cáo khoa học: "Primary malignant mixed Müllerian tumor arising from the mesorectum with a synchronous ovarian cancer: a case report and review of the literature" ppsx
Ngày tải lên :
11/08/2014, 03:20
... 11 Levine DA, Argenta PA, Yee CJ, Marshall DS, Olvera N, Bogomolniy F, Rohaman JA, Robson ME, Offit K, Barakat RR, et al: Fallopian tube and primary peritoneal carcinomas associated with BRCA ... carcinosarcoma of the ovary to therapy with doxorubicin, ifosfamide and dacarbazine Gynecol Oncol 19 91, 41: 1 61- 166 Sit AS, Price FV, Kelley JL, Comerd JT, Kunschner AJ, Kanbour-Shakir A, Edwards ... peritoneal malignant mixed Müllerian tumors A clinicopathologic, immunohistochemical, and genetic study Cancer 20 01, 91: 1052 -10 60 23 Mikami M, Kuwabara Y, Tanaka K, Komiyama S, Ishikawa M, Hirose...
- 5
- 475
- 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf
Ngày tải lên :
11/08/2014, 17:21
... urethral defects [1] In some cases, the search for new applicable materials became mandatory because of the morbidity associated with classical approaches and the deficiency of available well-vascularized ... urethrotomy using the Sachse technique without complications Two years later, the patient complained again of decreasing urine stream and frequency As shown in Figure 1A, maximal flow was 9.1ml/sec (micturition ... Thus postoperative morbidity and overall surgery time decrease 11 Andrich DE, Mundy AR: Substitution urethroplasty with buccal mucosal free grafts J Urol 20 01, 16 5 :11 31- 113 4 Filipas D, Fisch M,...
- 4
- 292
- 0
Báo cáo y học: " Penetrating injury of the hand with a door handle: a case report" ppt
Ngày tải lên :
11/08/2014, 19:21
... Lateral radiograph of hand debridement and washout was performed The wound was then reviewed after 48 hours and a delayed primary closure performed The patient had regained good hand function and ... Antero-posterior radiograph of hand Sinha M: An unusual foreign body in the hand J Hand Surg Eur Vol 2007, 32(2):2 31- 232 Chaudhry IA, Al-Sharif AM, Shamsi FA, Elzaridi E, Al-Rashed W: Severe ocular injuries ... initial management of the patient and reviewed the manuscript NS was the senior author responsible for the management of the patient References Figure Antero-posterior radiograph of hand Antero-posterior...
- 3
- 266
- 0