postmenopausal bleeding evaluation when should a woman with pmb be referred for additional evaluation
evidence-based imaging improving the quality of imaging in patient care
Ngày tải lên :
30/05/2014, 23:55
... L Santiago Medina, Diego Jaramillo, Esperanza Pacheco-Jacome, Martha C Ballesteros, Tina Young Poussaint, and Brian E Grottkau Contents xiii Part V Cardiovascular and Chest Imaging 23 Imaging ... assume that a patient with a congenital heart anomaly has a utility of 0.8 and he spends year in this health state The patient with the cardiac anomaly would have a 0.8 QALY in comparison with his ... quality of the meta-analysis can only be as good as the quality of the research studies that the metaanalysis summarizes In general, meta-analysis cannot compensate for selection and other biases...
- 702
- 1.7K
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... Medical Center, Harvard Medical School, Boston, MA, USA 4MIT, Boston, MA, USA 5Institut Guttmann, Universitat Autonoma de Barcelona, Barcelona, Spain 6Laboratory of Neuromodulation, Spaulding Rehabilitation ... Plains, NY, USA 2Center for Neuromuscular and Neurological Disorders, University of Western Australia, Perth, Australia 3Berenson-Allen Center for Noninvasive Brain Stimulation, Beth Israel Deaconess ... acquisition and learning are associated with an increase in target muscle cortical excitability and a modulation of intracortical inhibition, but the relationship of cortical excitability changes with...
- 8
- 432
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
Ngày tải lên :
19/02/2014, 07:20
... had been heated for at 95 °C, indicating that the cofactor was heat stable This heat-stable cofactor was dependent on ATP-Mg for its action and the inhibition that it exerted together with ATP-Mg ... with the spectrophotometric glucuronate assay Glucuronate was assayed enzymatically with E coli uronate isomerase and mannonate dehydrogenase [38] This method was also used to assay glucuronate ... 5521–5525 Yamashita A, Nagatsuka T, Watanabe M, Kondo H, Sugiura T & Waku K (1997) Inhibition of UDP-glucuronosyltransferase activity by fatty acyl-CoA Kinetic studies and structure-activity relationship...
- 12
- 659
- 0
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf
Ngày tải lên :
08/03/2014, 08:20
... centrifuged at 10 000 g for and cGMP in the supernatant was assayed by radioimmunoassay, as described earlier [28] To measure the manganesemediated activation of GC-C, mM manganese and mM GTP was used as ... dried and associated radioactivity monitored in an LKB gamma counter The data was analyzed using GRAPHPAD PRISM (San Diego, CA, USA) Immunodetection of GC-C Western blot analysis was performed with ... STY72F was iodinated using Na125I as described earlier [30] and was available in the laboratory Membrane protein (100–200 lg) was incubated with increasing concentrations of 125I-labeled STY72F for...
- 10
- 427
- 0
Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx
Ngày tải lên :
08/03/2014, 16:20
... contaminated the preparation) was clearly phosphorylated (Fig 3A) When an effort was made to enhance the autoradiograph image (32P panel in Fig 3B), a faint and diffuse signal appeared at a slightly ... obviously labeled band (arrowhead, molecular mass of 41 kDa, also seen on the 32P panel of Fig 3A) was judged to be from contamination of the PKA preparation because this band was not detectable with ... Ugai, S., Tamura, T., Tanahashi, N., Takai, S., Komi, N., Chung, C.H., Tanaka, K & Ichihara, A (1993) Purification and characterization of the 26S proteasome complex catalyzing ATPdependent breakdown...
- 9
- 404
- 0
Mobil 1 is original equipment in some of the world’s finest vehicles, including potx
Ngày tải lên :
08/03/2014, 19:20
... are applicable to your vehicle More information about ACEA can be found at www.acea .be 26 Special Applications for Mobil 1 Can Mobil be used in passenger-vehicle transmissions? For automatic transmissions, ... Porsche Cayenne Transsyberia Team Manager NASCAR “Mobil is the only motor oil I’ll trust in my race engine and in my own car.” – Sam Hornish Jr., NASCAR race driver GM Racing “Mobil has always been ... vehicles on the planet, providing an advanced and exacting test bed to develop lube and fuel technology that we all use in our road cars every day In short, if any area of a Formula One car is not up...
- 14
- 517
- 0
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf
Ngày tải lên :
15/03/2014, 14:20
... data was interpolated Data was seasonally adjusted using an X-12 ARIMA seasonal adjustment Public Debt 2012 April WEO Yearly actual and projected data was interpolated Data was seasonally adjusted ... gaps) Notwithstanding data limitations that may hinder the accuracy of the NRIR estimates, we also find that Costa Rica, Dominican Republic, Guatemala, and Paraguay, still have a somewhat accommodative ... actual annual inflation rate in the sample is taken as the target for that year One-year-ahead inflation expectations are based on one-year-ahead WEO forecasts (results are essentially the same...
- 48
- 504
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
Ngày tải lên :
16/03/2014, 11:20
... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... hybridization of ScaIdigested DNA A hybridization band of 4200 bp was obtained for the wild-type with a desA fragment (1372 bp) as probe, and a band of about 4220 bp was found for the mutant with aac(3)IV ... primarily through cadaverine: beta-lactam producers also make alphaaminoadipate J Bacteriol 171, 299–302 Gil JA & Hopwood DA (1983) Cloning and expression of a p-aminobenzoic acid synthetase...
- 13
- 456
- 0
Báo cáo khoa học: RCAN1-1L is overexpressed in neurons of Alzheimer’s disease patients pot
Ngày tải lên :
16/03/2014, 11:20
... alone LA RT-PCR was performed using a kit from Tamara Shuzo (TaKaRa Bio Inc.) and conditions had been adjusted to ensure that results were in a linear range and that a plateau had not been reached ... to label specific cell types with antibodies Anti-NeuN mAb was used to label neurons, anti-GFAP was used to label astrocytes, and antiHLA-DR was used to label microglia In this experiment, each ... 70 kDa band as RCAN1-4, the 38 kDa band as RCAN1-1L, and the 31 kDa band as RCAN1-1S Combined data from western blots from 12 control and 12 AD patients, in all regions tested (A1 0, A2 2, Hc and...
- 10
- 302
- 0
Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot
Ngày tải lên :
16/03/2014, 11:20
... were aligned using CLUSTAL W In the alignment shown are the sequences from plants [Arabidopsis thaliana (ARATH) and Nicotiana tabacum (TOBAC)], algae [Chlamydomonas reinhardtii (CHLRE) and Porphyra ... confirmation that the aadA cassette has inserted in the psaJ gene M, marker; 1, total DNA from transgenic plant as template; 2, plasmid DNA used to transform the plants as template; 3, total DNA from ... electrontransfer complex as revealed by mutant studies Biochemistry 35, 1249–1257 28 Nakamura Y, Kaneko T, Sato S, Mimuro M, Miyashita H, Tsuchiya T, Sasamoto S, Watanabe A, Kawashima K, Kishida Y,...
- 13
- 381
- 0
Neither of the children is interested in learning pptx
Ngày tải lên :
20/03/2014, 00:20
... trúc danh từ số nhiều (books, hotels, restaurants…) Cụ thể câu “children” – đ a trẻ, trẻ nói chung; danh từ số nhiều “child” – đ a bé, đ a trẻ - Cách chia động từ: Sau “neither of ” động từ chia ... “to be fond of + V-ing” = “to be keen on + Ving” – thích, hứng thú làm việc Ở “learning” danh động từ có động từ gốc “learn” – học, học tập, nghiên cứu Động từ “to be “is’ “are” => Dịch ngh a ... “neither of ” động từ chia số hay số nhiều Ví dụ: “Neither of the children is (are) interested in learning” Không đ a bọn trẻ thích học • Các hình thức liên quan khác - Sau “neither of” đại từ tân...
- 5
- 376
- 0
Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx
Ngày tải lên :
23/03/2014, 04:21
... glutamate, aspartate, asparagine, l-alanine, and d-alanine In Escherichia coli and Salmonella Cellular and Molecular Biology (Neidhardt FC, Curtiss R III, Ingraham JL, Lin ECC, Low KB, Magasanik ... cellular GSAMP deadenylylation rate was calculated as mGStotal ẳ mn ẵGStotal 12 7ị with [GStotal] the measured total GS concentration The measured values of the fractional uridylylation state Quantication ... realize function Materials and methods Bacterial strains and media The bacterial strains used are listed in Table YT agar plates contained YT medium [33] and 1.5% agar (Difco, Sparks, MD, USA)...
- 17
- 390
- 0
Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot
Ngày tải lên :
23/03/2014, 06:20
... N-acetylTyr-Val-Ala-Asp-7-amino-4-metylcoumarin for caspase 1, N-acetyl-Asp-Glu-Val-Asp-7-amino-4-metylcoumarin for caspase 3, N-acetyl-Val-Glu-Ile-Asp-7-amino-4-trifluorometylcoumarin for caspase and N-acetyl-Ile-Glu-ThrAsp-7-amino-4-trifluoromethylcoumarin ... Caspases are among the most specific proteases, with an unusual and absolute requirement for cleavage after aspartic acid [22] Recognition of at least four amino acids N-terminal to the cleavage ... that activation of caspase is greater and more sustained than that of caspase (Fig 2E) Moreover, caspase activation reached its maximum at or h after UV or sorbitol treatment, respectively, and...
- 14
- 360
- 0
Báo cáo khoa học: Hydrogen bond residue positioning in the 599–611 loop of thimet oligopeptidase is required for substrate selection pdf
Ngày tải lên :
23/03/2014, 06:20
... (CACCTCACTCCACAAGTAAGCATAGT ACTGAGCGTCGTA); FwRepG60 3A (CTTTTGGCCA CCTCGCTGCTGGCTACGACGCTCAGTAC); RvRepG60 3A (GTACTGAGCGTCGTAGCCAGCAGCGAGGTG 5614 GCCAAAAG); FwRepG60 4A (GGCCACCTCGCTGGTG CCTACGACGCTCAGTAC); ... TTCGACGCTCAG TACTATG); RvRepY605F (CATAGTACTGAGCGTCG AAGCCACCAGCGAGGTGG); FwRepY609F (GGCTA CGACGCTCAGTTCTATGGCTACTTGTGG); RvRepY609F (CCACAAGTAGCCATAGAACTGAGCGTCGT AGCC); FwRepY612F (GCTCAGTACTATGGCTTCTT ... CCTACGACGCTCAGTAC); RvRepG60 4A (GTACTGA GCGTCGTAGGCACCAGCGAGGTGGCC); FwRepG59 9A (CAACATGCCAGCCACTTTTGCCCACCTCGCT GGTGGCTACG); RvRepG59 9A (CGTAGCCACCAGC GAGGTGGGCAAAAGTGGCTGGCATGTTG); FwRepY605F (CCACCTCGCTGGTGGC...
- 11
- 395
- 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
Ngày tải lên :
24/03/2014, 04:21
... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... markers associated with airways hyperreactivity in asthmatics and platelet activating factor acetylhydrolase [29] Ober et al [30] recently reported strong linkage of 19q markers with asthma and ... for 18– 22 h Half of the plated cells were treated with 0.01 U sialidase (Calbiochem, La Jolla, CA) for h at 37 8C because the treatment has been shown to remove cell surface sialic acids that...
- 14
- 540
- 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
Ngày tải lên :
31/03/2014, 01:20
... following strategy Two partially complementary oligonucleotides 5¢-CGCGGAATTCTTAGTGATGGTGATG GTGATGTGTTGAAGCTTCCTTCAGGG-3¢ and 5¢-CAT CACCATCACCATCACTAAGAATTCCGCGATAGAA GCTTCAACATAAATAGGATACTA-3¢ were ... incubated either with antibodies raised against subunits e and i or with antibodies raised against subunits g and i cells of e1 9A, eG15L and eG19L strains had abnormal mitochondria such as onion-like ... serum albumin as standard Oxygen consumption rates were measured with NADH as substrate [28] Phosphorylation rate was measured in the respiratory buffer supplemented with mM ADP by ATP formation...
- 10
- 550
- 0
“The hardest thing to see is what is in front of your eyes.” potx
Ngày tải lên :
31/03/2014, 22:20
... Palo de aceiti El Salvador: Teberinto French Guiana: Saijhan Guadeloupe: Moloko Guatemala: Perlas Haiti: Benzolive Honduras: Maranga calalu Nicaragua: Marango Panama: Jacinto Puerto Rico: Resada ... Resada Asia Suriname: Kelor Bangladesh: Sajina Trinidad: Saijan Burma: Dandalonbin Oceania Cambodia: Ben ailé India: Sahjan, Murunga, Moonga Indonesia: Kalor Pakistan: Suhanjna Philippines: Mulangai ... Senegal: Neverday, Sap-Sap Somalia: Dangap Sudan: Ruwag Tanzania: Mlonge Togo: Baganlua, Yovovoti Zimbabwe: Mupulanga Brazil: Cedro Colombia: Angela Costa Rica: Marango Cuba: Palo Jeringa Dominican...
- 20
- 476
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2