0

position modifiers in a sentence so that they modify the right word and only that word

Báo cáo khoa học:

Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

Báo cáo khoa học

... Developing a natural language interface to complex data ACM Tr(uts on D=t~bsse ~l/stsrrts, (1978), 2, pp 105-147 I BaUard, B A "Domain Class" approach to transportable natural language processing ... language question answering system for a large relational database Cowzm A C M 21 (1978), 7, pp 526-539 22 Woods, W Semantics and quantification in natural language question answering In Advances ... N A phrase-structured grammatical formalism for transportable natural language processing, llm~r J Cow~p~t~zt~na~ L~n~ist~cs, to appear 24 Ginsparg, J A robust portable natural language data...
  • 5
  • 452
  • 0
A preposition describes a relationship between other words in a sentence pdf

A preposition describes a relationship between other words in a sentence pdf

Kỹ năng nói tiếng Anh

... understanding of ADJECTIVES and PREPOSITIONS afraid of angry at aware of capable of careless about familiar with fond of happy about interested in jealous of made of married to proud of similar to sorry ... prepositions in idiomatic usage would require volumes, and the only way English language learners can begin to master the intricacies of preposition usage is through practice and paying close attention ... about think about trust in work for worry about A combination of verb and preposition is called a phrasal verb The word that is joined to the verb is then called a particle Please refer to the brief...
  • 8
  • 353
  • 0
Complete the second sentence so that means the same as the first

Complete the second sentence so that means the same as the first

Đề thi tuyển dụng

... ma a glass of wine “Would you like a glass of wine?”, he said 28 They changed their plan because the weather was bad Due to bad weather, they changed their plan 29 The increasing number of cars ... “Don’t walk on the grass”, the gardener said to us The gardener told us not to walk on the grass 21 Somebody repaired her car yesterday She had her car repaired 22 You must see the manager tomorrow ... worth trying to make her change her mind There’s no point trying to make her change her mind 17 He was driving very fast because he didn’t know the road was icy If he had known the road was icy,...
  • 2
  • 1,092
  • 2
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

Khoa học xã hội

... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
  • 137
  • 853
  • 0
Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling

Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling

Môi trường

... by the leaf area Roughly, the plant height increased until 120 days after transplantation, and thereafter a constant height was maintained in every case The leaf area index (LAI), however, increased ... to calculate the decrease in the ratio of the rice assimilation amount to the total nitrogen inflow that occurs with the increase in the water supply rate in the pots The mathematical model and ... shown in Fig In the 0.6 m3/(m2∙day) case, the water level was increased from early October, and clogging was presumed However, the discharge rate was maintained, and we concluded that the effect...
  • 16
  • 581
  • 1
Applications of Calorimetry in a Wide Context - Differential Scanning Calorimetry, Isothermal Titration Calorimetry and Microcalorimetry docx

Applications of Calorimetry in a Wide Context - Differential Scanning Calorimetry, Isothermal Titration Calorimetry and Microcalorimetry docx

Năng lượng

... thermal scansheating/cooling, and isothermal cycles), a pressure (stable) and an atmosphere (inert or reactive) Principally, sample and reference are maintained at the same temperature, while any ... sample The change of a crystals size and a form during the annealing can be revealed by a X-Ray analysis but the change in the percentage of crystalline phase is detectable also by the DSC analysis ... Romanini, Mauricio Javier Braia and Mar a Cecilia Porfiri Chapter Insights into the Relative DNA Binding Affinity and Preferred Binding Mode of Homologous Compounds Using Isothermal Titration Calorimetry...
  • 484
  • 3,011
  • 0
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc

Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc

Báo cáo khoa học

... and observed that the genes PA0266 and PA0265 work as 5-aminovalerate aminotransferase and glutarate semialdehyde dehydrogenase, catalyzing successive chemical reactions from 5-amino pentanoate ... predicting PA0266 as a putative 5-aminovalerate aminotransferase and PA0265 as a putative glutarate semialdehyde dehydrogenase Recently, a report has suggested candidate genes for 5-aminovalerate aminotransferase ... aminotransferase and glutarate semialdehyde dehydrogenase in the lysineA PA0266 2-Oxoglutarate B PA0265 Glutarate semialdehyde 5-Aminovalerate NADP+ Glutamate NADPH Absorbance at 340 nm 0.20 a...
  • 12
  • 441
  • 0
Đề tài

Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

Thạc sĩ - Cao học

... TOBIAS H COLDING AND WILLIAM P MINICOZZI II To achieve this, we will solve two Plateau problems using Σ as a barrier and then use the fact that Σ3 separates y1 , y2 near y to get that these are in ... proportional to max |A| B Such a potentially small N -valued graph sitting inside Σ can then be seen to extend as an N -valued graph inside Σ almost all the way to the boundary That is, the small N -valued ... understanding such surfaces is to understand the local structure in a ball and in particular the structure of an embedded minimal disk in a ball in R3 (with the flat metric) This study is undertaken...
  • 43
  • 410
  • 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khoa học

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ... the amino acids at positions and in a model substrate protein having a sequence MGAAAAAAAA at its N-terminus was performed and the susceptibility of these mutants to protein N-myristoylation was...
  • 12
  • 512
  • 0
CHILD HEALTH CARE DEMAND IN A DEVELOPING COUNTRY: UNCONDITIONAL ESTIMATES FROM THE PHILIPPINES doc

CHILD HEALTH CARE DEMAND IN A DEVELOPING COUNTRY: UNCONDITIONAL ESTIMATES FROM THE PHILIPPINES doc

Sức khỏe trẻ em

... 23 Individual- and household-level variables are also presented in Appendix Tables and 10 They consist of age and sex of the index child, mother=s and father=s education and age, and mother's ... 150) also has a positive influence on modern private and public demand, indicating that this variable may capture accumulated human capital and family background characteristics of the mother ... the data and the resulting parameter estimates are saved as a data set Using the collection of estimated parameter sets from these replications, one can calculate the standard deviation of each...
  • 101
  • 298
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot

Điện - Điện tử

... relevant intellectual content LB performed all the measurements and was involved in drafting the manuscript CP and AF participated in data acquisition and analysis SG gave final approval of the version ... test and chair-stand test Disability was assessed using selfreport instruments: the Barthel Index [63] and the Nottingham Extended Activities of Daily Living (ADL) Index [64] The clinical evaluation ... metatarsal head, right fifth metatarsal head, left fifth metatarsal head During posture analysis, in order to relate the displacement of the marker arrays to the position of the 3D underlying...
  • 11
  • 557
  • 0
báo cáo hóa học:

báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc

Hóa học - Dầu khí

... strengthened the evidence that the mass media is making the desired impact with regard to information about HIV/AIDS in Nigeria The impact of healthcare providers/institutions in the dissemination ... for screening voluntarily or acknowledging their HIV status It was not surprising, therefore, that the majority of the patients said that they would maintain secrecy should any of their family members ... sexual behaviors, and condom use Data Analyses The data were analyzed using the Statistical Package for Social Sciences (SPSS), version 10.[15] All statistical tests were at 5% probability level...
  • 6
  • 556
  • 0
báo cáo hóa học:

báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx

Hóa học - Dầu khí

... comparative purposes The implementation of such an approach has limitations in that it requires a substantial (and continuing) investment in quality control, training and access to a central facility ... examination of the patterning in the residuals and the magnitude of the fist residual component in a Principal Component Analysis of the residuals This analytical strategy has been described in ... RSM [35] and suggested a five-category scale Claesson and Svensson [36] used the rank-invariant statistical method and suggested a scale reduced to four categories, as did also Heinemann and coworkers...
  • 8
  • 301
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Effects of sylvicultural practices on nutrient status in a Pinus radiata plantation: Nutrient export by tree removal and nutrient dynamics in decomposing logging residues" ppt

Báo cáo khoa học

... for radiata pine slash needles and twigs incubated in the thinned stand and in the prepared and unprepared plots after clear-felling indicates that initial levels of N in decomposing material were ... year in a thinned stand and in an adjacent clear-cut area In the latter, the effect of intensive site preparation involving logging residue incorporation to the mineral soil was compared with the ... substantially following clear-cutting Thus, the mean daily temperatures in the Table III Annual accumulation, return, leaching and uptake of the radiata pine stand For leaching, values in brackets...
  • 12
  • 266
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: " Survival and growth of Pinus halepensis Miller seedlings in a semi-arid environment after forest soil transfer, terracing and organic amendments" docx

Báo cáo khoa học

... halepensis in the semi-arid climate of southeast Spain The addition of USR enhanced plant growth in all the treatments Roldán and Albaladejo (1994) demonstrated that the application of small amounts ... mechanical terraces, the organic amendment was incorporated into the top 30 cm of the whole terrace using a rotovator In the manual terraces, the refuse was only incorporated into the planting holes ... the Carrascoy range in Murcia Province (southeast Spain) The climate is semi-arid Mediterranean, with extremely hot and dry summers The average annual rainfall is 300 mm, occurring mostly in autumn...
  • 14
  • 313
  • 0
báo cáo khoa học:

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

Báo cáo khoa học

... from the prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands and the well-differentiated non functioning pancreatic endocrine carcinoma, functioning bilateral adrenocortical ... tumor in the body and tail of the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral subcostal incision ... excessive amounts of hormones such as gastrin, insulin, glucagon, somatostatin, neurotensin or vasoactive intestinal polypeptide and are associated with distinct clinical syndromes [2] Pancreatic...
  • 7
  • 412
  • 0
Báo cáo y học:

Báo cáo y học: "Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients" potx

Báo cáo khoa học

... populations from the US, Canada and Spain, and nearly identical to data reported from Great Britain and New Zealand [5-10] However, the carrier frequency of the 1858T allele in RA patients was ... immunogenetic associations in male and female RA patients have also been described for several HLA DRB1 alleles [28,29] One possible explanation of these findings is that male and female RA are partially ... declare that they have no competing interests Authors' contributions MP designed the study, oversaw all aspects of the laboratory work, analyzed the data and prepared the manuscript SK, SA, MW and...
  • 7
  • 420
  • 0
Báo cáo y học:

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo khoa học

... centrifugation at 14,000 rpm for 15 minutes to separate into an aqueous RNA phase, an organic protein layer and a DNA interphase RNA was extracted by adding 0.5 ml isopropanol to the aqueous phase and ... work including all the molecular analyses JS participated in the field work; GM and SEM participated in drafting the manuscript All authors read and approved the final manuscript Competing interests ... Ginde AA, Mansbach JM, Camargo CA Jr: Association between serum 25hydroxyvitamin D level and upper respiratory tract infection in the Third National Health and Nutrition Examination Survey Arch...
  • 11
  • 527
  • 0

Xem thêm