0

phân tích quy mô của kqsx tt

Giao trinh co so du lieu potx

Giao trinh co so du lieu potx

Cơ sở dữ liệu

... CSDL cú s c H l nhng ngi cp quyn hn khai thỏc CSDL, vy h cú th gii quyt c cỏc tranh chp d liu nu cú 1.1.5 H Qun Tr C S D Liu (Data Base Management System) gii quyt tt nhng m cỏch t chc CSDL ... tin v cp quyn hn khai thỏc CSDL cho ngi s dng., -T in d liu: Dựng mụ t cỏc ỏnh x liờn kt, ghi nhn cỏc thnh phn cu trỳc ca CSDL, cỏc chng trỡnh ng dng, mt mó, quyn hn s dng, -C ch gii quyt tranh ... riờng gii quyt cỏc ny Mt s bin phỏp sau õy thng c s dng: th nht: cp quyn u tiờn cho tng ngi s dng; th hai: ỏnh du yờu cu truy xut d liu, phõn chia thi gian, ngi no cú yờu cu trc thỡ cú quyn truy...
  • 113
  • 238
  • 0
Thực trạng và giải pháp phát triển hệ thống cửa hàng tiện lợi Citimart B and B

Thực trạng và giải pháp phát triển hệ thống cửa hàng tiện lợi Citimart B and B

Quản trị kinh doanh

... B&B Nam Long 2.3 Phân tích SWOT Dựa phân tích bên trên, nhóm nghiên cứu xin trình bày bảng phân tích SWOT cửa hàng Strengths - Weaknesses Hệ thống cửa hàng đồng nhất, - Diện tích, mặt phần lớn ... Bước 3: Phân tích hoạt động chuỗi cửa hàng tiện lợi Citimart Từ thông tin thu thập từ khảo sát nguồn thông tin báo chí, viết chuyên gia lĩnh vực phân phối – bán lẻ, nhóm nghiên cứu phân tích hoạt ... 03 1.2 Phương pháp khảo sát, phân tích đánh giá 04 Chương 2: THỰC TRẠNG HOẠT ĐỘNG CỦA CÁC CỬA HÀNG 2.1 Phân khúc thị trường khách hàng mục tiêu 05 2.1.1 Phân khúc thị trường cửa hàng...
  • 29
  • 1,225
  • 6
B and V Minimal Pair Quiz .doc

B and V Minimal Pair Quiz .doc

Tiếng anh

... veil In Japan a twenty year old is permitted to _ , smoke cigarettes and drink alcohol a boat b vote This computer is the _ of my existence! It keeps shutting down a vain b vein c vane d bane ... Click the answer button to see the answer There is a worldwide _ on ivory trade a ban b van The _ on the mistletoe plant is white but that of the holly is red a berry b very http://binhqx.violet.vn ... bow b vow 15 Love songs are often written in the form of a _ a ballad b valid 16 Plates and glasses can kept clean in the kitchen _ a covered b cupboard 17 http://binhqx.violet.vn One of the...
  • 12
  • 444
  • 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Báo cáo khoa học

... by reducing SDS ⁄ PAGE followed by western blotting with polyclonal antiserum against the synthetic peptide KX5KDEL ETA-A was detected under the latter experimental conditions Rat liver endosomal ... treatment on the a2MG ⁄ LRP1 receptor in the rat liver endosomal fraction was determined by immunoblotting (Fig 2A, upper blot) A high concentration of a membrane-bound 80 kDa fragment of LRP1 containing ... with antibody directed against ETA-A It was assumed that the in vivo generation of free ETA-A was attributable to both reductive and proteolytic cleavages occurring within the ETA sequence Thus,...
  • 15
  • 588
  • 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Báo cáo khoa học

... sequential binding sites model, whereby the user defines the number of binding sites to be fitted in a sequential manner Attempts to fit data to anything other than one or two identical site models gave unsatisfactory ... Tolle DP & Barrett AJ (2004) MEROPS: the peptidase database Nucleic Acids Res 32, D160– D164 10 Turk V & Bode W (1991) The cystatins: protein inhibitors of cysteine proteinases FEBS Lett 285, 213–219 ... three-dimensional domain swapping Nat Struct Biol 8, 316–320 18 Di Giamo R, Riccio M, Santi S, Galeotti C, Ambrosetti DC & Melli M (2002) New insights into the molecular basis of progressive myoclonus epilepsy:...
  • 14
  • 586
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Sức khỏe giới tính

... http://www.nap.edu/catalog/12793.html ACKNOWLEDGMENTS The committee acknowledges the valuable contributions made by the many persons who shared their experience and knowledge with the committee ... written and verbal testimony provided by members of the public affected by hepatitis B or hepatitis C Several persons contributed their expertise for this report The committee thanks David Hutton, ... Correctional Settings 148 Community Health Facilities 150 Targeting Settings That Serve At-Risk Populations 151 References .154 A COMMITTEE BIOGRAPHIES...
  • 191
  • 457
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Sức khỏe giới tính

... Acknowledgments T he committee acknowledges the valuable contributions made by the many persons who shared their experience and knowledge with the committee The committee appreciates the time ... written and verbal testimony provided by members of the public affected by hepatitis B or hepatitis C Several persons contributed their expertise for this report The committee thanks David Hutton, ... Pregnant Women, 181 Correctional Settings, 184 Community Health Facilities, 186 Targeting Settings That Serve At-Risk Populations, 189 References, 192 147 A COMMITTEE BIOGRAPHIES B PUBLIC MEETING...
  • 253
  • 369
  • 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học

... ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG ... codon of elongin C was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢ After digestion of the PCR fragment by EcoRI and AgeI, ... synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS...
  • 9
  • 420
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Sức khỏe giới tính

... Improved surveillance and better integration of viral hepatitis services are needed to fix this problem comes in infected people To improve knowledge and awareness, the committee recommends that the ... vaccination rates Therefore, the committee recommends that all states mandate the hepatitis B vaccine series be completed or in progress as a requirement for school attendance Because only about half ... Bureau of Infectious Disease Prevention, Response, and Services, Massachusetts Department of Health, Jamaica Plain, Massachusetts Alison A Evans Assistant Professor, Department of Epidemiology and...
  • 4
  • 404
  • 1
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

Báo cáo khoa học

... was carried out using primer F1466 (5¢-GTGTGTGTCAAGCCCACTTTTCTG-3¢) of the coding sequence and primer R1863 (5¢-GTGGG TGGTGGATTTTGTTGTTTG-3¢) of the 3¢-UTR sequence of Rnf33 to generate a 398-bp ... lm each of forward and reverse primers PCR primers for Rnf33 were F1466 and Rnf33-qPCR-R (5¢-GTTCTTAGAGGTCCA TAGGTGACA-3¢) For normalization, the mRNA level of the glyceraldehyde-3-phosphate ... competition experiments were: wild type, 5¢-AGGTCTGGGAATTCCC CCCGGA-3¢; and mutant 5¢-AGGTCTGGGAATagggCCC GGA-3¢ (mutated nucleotides shown in lowercase letters) For supershift assays, 2.5 lg of a polyclonal...
  • 14
  • 381
  • 0
hepatitis b and d protocols volume 1

hepatitis b and d protocols volume 1

Sinh học

... TCTCATCTGCCGGACCGTGT GGACCGTGTGCACTTCGCTT GCACTTCGCTTCACCTCTGC TCACCTCTGCACGTCGCATG TCCATGCGACGTGCAGAGGTGAAGC GACCGACCTTGAGGCATACTTCAAAGACTG CCTCAAGGTCGGTCGTTGAC CAGTCTTTGAAGTATGCCTCAAGGTCGGTC AATTTATGCCTACAGCCTCC ... CCTCAAGGTCGGTCGTTGAC CAGTCTTTGAAGTATGCCTCAAGGTCGGTC AATTTATGCCTACAGCCTCC ACCAGCACCATGCAACTTTT (T)15 GCTGG GTGCCTTGGGTGGCTTTAGGGCATGGACAT (T)15 AGCTC (T)15 GAAGC AGAGAGTAACTCCACAGAAG a Oligonucleotides ... Primer 5: GGAGTGGGATTCGCACTCC (2269–2288) Primer 6: ATACTAACATTGAGATTCCC (2457–2438) Primer set for the second PCR: Primer 7: AGACCACCAAATGCCCCTAT (2299–2318) Primer 8: GATCTTCTGCGACGCGGCGA (2429–2410)...
  • 333
  • 403
  • 0
hepatitis b and d protocols volume 2

hepatitis b and d protocols volume 2

Sinh học

... Y14137) IL4: Sense primer 5'-AGAGCTATTGATGGGTCTCA-3', antisense primer 5'-TCTTTAGG CTTTCCAGGAAGTC-3' (accession number AF082495) IL10: Sense primer 5'-GTGAAGATTTTCTTTCAAA-3', antisense primer 5'-GAGGTAT ... 5'-TTTCTACCTCAGACTCTTTGAA-3', antisense primer 5'-AGTT TTAAATATTAATAAATAG-3' (accession number Y14138) TNF-␣: Sense primer 5'-AGAAAAGACACCATGAGCACAGAAAA-3', antisense primer 5'-ACCCATTCCCTTCACAGAGCAATGA-3' ... polymerase (Geneworks, Adelaide, cat no BTQ-1) Forward PCR primer 2554: TTCGGAGCTGCCTGCCAAGG Reverse PCR primer 269c: GGAGCACCTGAGCTTGGATC 500 mM Tris-HCl, pH 6.8 0.06 M acetate buffer, pH 4.0 (Add...
  • 549
  • 454
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

Hóa học - Dầu khí

... function of human CD4+ Treg cells J Exp Med 2006, 203:1701-1711 11 Chiarini M, Sottini A, Ghidini C, Zanotti C, Serana F, Rottoli M, Zaffaroni M, Bergamaschi R, Cordioli C, Capra R, Imberti L: Renewal ... dysfunction in multiple sclerosis J Immunol 2007, 179:1322-1330 13 Sottini A, Ghidini C, Zanotti C, Chiarini M, Caimi L, Lanfranchi A, Moratto D, Porta F, Imberti L: Simultaneous quantification of recent ... mutated; unm, unmutated; FISH, fluorescence in situ hybridization Motta et al Journal of Translational Medicine 2010, 8:111 http://www.translational-medicine.com/content/8/1/111 Page of Figure...
  • 7
  • 559
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Điện - Điện tử

... Cancer 2005, 44:52-64 19 Bamford S, Dawson E, Forbes S, Clements J, Pettett R, Dogan A, Flanagan A, Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of Somatic Mutations in Cancer) ... 9:110 http://www.translational-medicine.com/content/9/1/110 content and analyzed using FlowJo software (Tree Star) which incorporates the Watson pragmatic algorithm Histograms were plotted as ... Medicine 2011, 9:110 http://www.translational-medicine.com/content/9/1/110 16 Drexler H: Guide to Leukemia-Lymphoma Cell Lines 2005 17 American Type Culture Collection [http://www.atcc.org] 18...
  • 10
  • 618
  • 0
báo cáo hóa học:

báo cáo hóa học: " Aspirin-triggered lipoxin A4 attenuates LPSinduced pro-inflammatory responses by inhibiting activation of NF-B and MAPKs in BV-2 microglial cells" pptx

Hóa học - Dầu khí

... were used (Invitrogen): 5’CAGCTGGGCTGTACAAACCTT-3’ and 5’- CATTGGAAGTGAAGCGTTTCG-3’, which amplify the 95 bp product for iNOS; 5’-CAACCAACAAGTGATATTCTCCATG-3’ and 5’- GATCCACACTCTCCAGCTGCA-3’, ... 2011, 8:95 http://www.jneuroinflammation.com/content/8/1/95 CATCTTCTCAAAATTCGAGTGACAA-3’ and 5’TGGGAGTAGACAAGGTACAACCC-3’, which amplify the 175 bp product for TNF-a; and 5’TGTCCACCTTCCAGCAGATGT-3’ ... prepared as described above Oligonucleotides corresponding to the NF-B (5’-AGTTGAGGGGACTTTCCCAGGC-3’) and AP-1 (5’CGCTTGATGAGTCAGCCGGAA-3’) binding site consensus sequences were synthesized and...
  • 12
  • 414
  • 0
o cáo hóa học:

o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

Hóa học - Dầu khí

... Cancer 2005, 44:52-64 19 Bamford S, Dawson E, Forbes S, Clements J, Pettett R, Dogan A, Flanagan A, Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of Somatic Mutations in Cancer) ... 9:110 http://www.translational-medicine.com/content/9/1/110 content and analyzed using FlowJo software (Tree Star) which incorporates the Watson pragmatic algorithm Histograms were plotted as ... Medicine 2011, 9:110 http://www.translational-medicine.com/content/9/1/110 16 Drexler H: Guide to Leukemia-Lymphoma Cell Lines 2005 17 American Type Culture Collection [http://www.atcc.org] 18...
  • 10
  • 665
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effect of Interfacial Bonds on the Morphology of InAs QDs Grown on GaAs (311) B and (100) Substrates" potx

Hóa học - Dầu khí

... Sanguinetti et al., Europhys Lett 47, 701 (1999) doi:10.1209/ epl/i1999-00446-x 19 B.L Liang et al., Nanoscale Res Lett 2, 609 (2007) doi: 10.1007/s11671-007-9103-3 20 J.H Li et al., Phys Rev Lett ... threedimensional (3D) QDs which demonstrated the transition of 2D–3D growth mode, the intensity of one spotty pattern was recorded The atomic force microscopy (AFM) test was conducted in a contact mode in ... structures grown both on GaAs (311) B substrates by recording the dependence of intensity of one spotty pattern on the InAs coverage The results can be seen in Fig A clear delay for the growth-mode transition...
  • 5
  • 326
  • 0
Báo cáo toán học:

Báo cáo toán học: " Geometrically constructed bases for homology of partition lattices of types A, B and D" ppt

Báo cáo khoa học

... of Dowling lattices Gottlieb and n Wachs [13, Section 9] have constructed splitting bases for general Dowling lattices The splitting basis for Πn is a special case of this Dowling lattice construction ... variation of the Dowling lattice splitting basis which does reduce to the type B splitting basis given here Although the only Dowling lattices that are intersection lattices of real hyperplane ... real hyperplane arrangements are the partition lattice and the signed partition lattice, there are other Dowling lattices that are intersection lattices of complex hyperplane arrangements (cf [13,...
  • 26
  • 288
  • 0
Báo cáo y học:

Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc

Báo cáo khoa học

... encompassing the NF-κB recognition sites in the promoter of IL-6 (5′-TCGACATGTGGGATTTTCCCATGAC-3′) and IL-8 (5′-TCGAGCGTGGAATTTCCTCTGG-3′), as well as the AP-1 (activating-protein-1) recognition sites ... primers: IL-17R, sense 5′-GGGATTACAGGCGTGAGCCA3′, antisense 5′-GCGGTCTGGTTATCGTCTAT-3′; IL-17RB, sense 5′-TCATCTGCACAACTCCGTGG-3′, antisense 5′-TCGAATGTTAAGGCTACATT-3′; and GAPDH, sense 5′-CGATGCTGGGCGTGAGTAC-3′, ... washed times with TTBS, horseradish-peroxidaseconjugated secondary antibodies (Amersham Pharmacia) were added and allowed to incubate for 30 at room temperature After being washed in TTBS, hybridized...
  • 9
  • 411
  • 0
Báo cáo y học:

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo khoa học

... Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG (sense) and GGTCCACCACCCTGTTGCTGTAGCC (antisense) as primers ... incubated for 10 with enhanced diaminobenzidine in stable peroxi- dase buffer (Pierce; Perbio Science, Etten-Leur, The Netherlands) Following extensive washing in milli-Q water and dehydration, coverslips ... removed by centrifugation for 10 at 8.000 N/kg The supernatant was sterilized by Available online http://arthritis-research.com/content/7/6/R1271 membrane filtration using filters of pore sizes 0.8...
  • 10
  • 462
  • 0

Xem thêm