phosphorescence as a probe of the amorphous state

top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

Ngày tải lên : 22/12/2014, 22:04
... dynamically generates their mass The interaction terms between the Higgs boson and the matter fields are added in the Yukawa sector of the Lagrangian Note as well that the gauge bosons have their masses ... compared to the other particles in the Standard Model It belongs to the classification of a “quark” in the Standard Model, of which there are six flavours An interesting effect of the fact that quarks ... predicts a resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies...
  • 251
  • 712
  • 0
Reading Theory as a Microcosm of the Four Skills

Reading Theory as a Microcosm of the Four Skills

Ngày tải lên : 06/09/2013, 10:10
... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions...
  • 5
  • 680
  • 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

Ngày tải lên : 19/02/2014, 12:20
... and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity of the ... mutase–prephenate dehydratase were deleted Monofunctional versions of the dehydratase and the dehydrogenase are provided by plasmid pKIMP-UAUC Random gene libraries are introduced into this strain ... as obvious as the interaction of Arg90 with the oxyanion in the transition state, the BsCM structure suggests that Glu78 could be important for carbocation stabilization in the transition state...
  • 8
  • 635
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Ngày tải lên : 22/02/2014, 07:20
... electroporation b-Galactosidase (b-gal) assays, Southern blotting and PCR b-Gal assays and Southern blotting were performed as described previously [10,17] The 32 P-labelled probe was generated by ... for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing two wells containing about  105 cells (C) Normalized b-Gal ... important It implies that the steady -state intracellular concentration of gd102NLS at genomic and at episomal targets must be in the same range The centers of the loxP site and of the site I of...
  • 7
  • 472
  • 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20
... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the ... general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a chains The rates of oxidation are...
  • 6
  • 748
  • 0
CLOTELLE: A TALE OF THE SOUTHERN STATES pdf

CLOTELLE: A TALE OF THE SOUTHERN STATES pdf

Ngày tải lên : 15/03/2014, 03:20
... the evening of the third day of the passage, the lights of another steamer were soon in the distance, and apparently coming up very fast This was the signal for a general commotion on board the ... want and never will have another man," replied the woman "What's your name?" asked a man in a straw hat of a tall negro who stood with his arms folded across his breast, leaning against the wall ... was here that, in former days, her beautiful countenance had made her appearance as fascinating and as lovely as that of Cleopatra's Her sweet, musical voice might have been heard in every part...
  • 119
  • 350
  • 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... lm Taxol did not cause increase of acetylated tubulin (Fig 1E), indicating that the acetylation state of tubulin depends mainly on the relative activities of the acetylating and deacetylating...
  • 14
  • 416
  • 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

Ngày tải lên : 18/06/2014, 22:20
... promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed ... Statistics Canada Classification of chronic conditions The respondents were asked to indicate whether they had a disease or another health condition diagnosed by a health professional that had ... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased...
  • 11
  • 619
  • 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Ngày tải lên : 18/06/2014, 22:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
  • 5
  • 310
  • 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Ngày tải lên : 20/06/2014, 04:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
  • 5
  • 365
  • 0
Hey, buddy, wanna buy a piece of the empire state building pdf

Hey, buddy, wanna buy a piece of the empire state building pdf

Ngày tải lên : 11/08/2014, 09:25
... security in the Pacific The United States entered the war in nineteen forty-one after Japanese planes attacked the Navy base at Pearl Harbor, Hawaii The surprise attack sank many ships After that, Congress ... of dollars in defense spending for Alaska Today, federal spending is one of the most important parts of the state economy After the war, Alaskans were more serious than ever about statehood They ... criticized the purchase But it was one of the best deals the country ever made Alaska proved rich in oil and minerals Gold was found nearby in the Yukon area of Canada in the eighteen...
  • 3
  • 339
  • 0
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf

Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf

Ngày tải lên : 11/08/2014, 14:20
... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... transvaginal sonogram revealed a sac situated external to the endometrial cavity in the right cornua of the uterus (>1 cm from the most lateral edge of the uterine cavity) containing an embryo measuring ... the data regarding cornual pregnancy and was a major contributor in writing the manuscript Both authors approved the final manuscript Although non-surgical treatment of cornual pregnancies faces...
  • 4
  • 341
  • 0
Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps

Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps

Ngày tải lên : 12/08/2014, 19:22
... catheter, approximately 20 hours after the removal of the introducer, the patient’s cardiac index was elevated and the systemic vascular resistance was low These parameters normalized during the ... vascular resistance, tachypnea, fever and diffuse intravascular coagulation) was compatible with the diagnosis of SIRS The rapidity of the patient’s recovery, as well as the lack of positive cultures, ... clinical diagnosis of diffuse intravascular coagulation The patient was transfused several units of packed red blood cells, fresh frozen plasma, platelets and cryoprecipitate Intravenous antibiotic...
  • 3
  • 219
  • 0
the subsidy regulations and vietnam’s position as a member of the wto

the subsidy regulations and vietnam’s position as a member of the wto

Ngày tải lên : 18/08/2014, 12:35
... classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... determine the term "benefit", the Panel as the Appellate Body of the WTO has provided explanations that create the general principles to be used in cases For example, in the case “Canada – Measures Affecting ... ska visas här Agricultural subsidies are mainly governed by the AoA though the SCM is also applied in some cases That means the AoA and the SCM may even be in conflict The AoA may legally allow...
  • 59
  • 314
  • 0
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided

Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided

Ngày tải lên : 30/09/2015, 16:58
... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... requirement SmallCap companies may receive an additional 180 day grace period to achieve compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other listing ... 204.16 The notice to the exchange should be provided as soon as possible after the declaration date and preferably, at least ten days in advance of the record date Among other items, the notice...
  • 217
  • 227
  • 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Ngày tải lên : 13/02/2014, 05:20
... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The South ... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons...
  • 28
  • 665
  • 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

Ngày tải lên : 22/03/2014, 11:20
... 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations comes ... Decline of the welfare state Teeple [11] sees increasing income and wealth inequalities and the weakening of social infrastructures within Canada and elsewhere as resulting from the ascendance of ... disabilities—is relatively low as compared to all nations except the US The low US rate may reflect the lack of available Table Reports of being a victim of crime as percentage of total population...
  • 17
  • 843
  • 0
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

Ngày tải lên : 17/02/2014, 19:20
... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will have wider acceptance as a book from having been a magazine serial I am ... sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has been engaged,...
  • 21
  • 544
  • 0
Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx

Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx

Ngày tải lên : 19/02/2014, 10:20
... aesthetic The science of the “beautiful” in a work of art The aesthetic appeal of a work of art is defined by the visual Social, ethical moral, and contemporary standards of a society armature A ... Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal) The Huntington Library, Art ... side of a stick and two baseballs on the other—balancing out the picture balance A principal of art and design concerned with the arrangement of one or more elements in a work of art so that they...
  • 6
  • 681
  • 0