pervasive impacts of a complex condition
Bipolar Disorder – A Portrait of a Complex Mood Disorder Edited by Jarrett Barnhill docx
Ngày tải lên :
08/03/2014, 00:20
... signaling and a elevated protein kinase A activity ( Langan & McDonald 2009 ) The calcium channels antagonists (verapamil and others) raise carbamazepine effect Magnesium, acting like a natural calcium ... increases the verapamil maintenance therapy in mania (Giannini et al 2000) This fact favors the idea that an increase in magnesium concentration is an important fact, maybe essential for the therapeutic ... of Action 57 Carla P Fonseca, Liliana P Montezinho and M Margarida C .A Castro Chapter Memantine: A New Mood Stabilizer for Treatment-Resistant Bipolar Disorders 99 Gino Serra, Giulia Serra, Alexia...
- 250
- 431
- 0
Making sense of a complex world Accounting for royalty arrangements – issues for media companies pptx
Ngày tải lên :
29/03/2014, 20:20
... an upfront payment for future royalties Royalties earned on the book’s sales are offset against the advance and only once the book generates more royalties than the value of the advance are additional ... typically calculated per listener hour However, there are a wide variety of royalty arrangements e.g royalties may also be a fixed amount per track play or a percentage of revenue generated As ... show games for a period, and these broadcast royalties are then shared among the teams Issue: 4 MIAG 11 “Is a licensor's advance a financial and monetary liability?” 12 MIAG Issue: Accounting...
- 30
- 481
- 0
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
Ngày tải lên :
30/03/2014, 23:20
... Kanbayashi and Toyoshi Hosokawa Preface Understanding the rapid changes in the evaluation and management of peripheral neuropa‐ thies, as well as the complexity of their mechanism, is a mandatory ... Hosokawa, Lauren E Ta, Emily Ramirez, Anthony Windebank, Charles Loprinzi, Kathrine Jáuregui-Renaud, Sabatino Maione, Enza Palazzo, Javier Lopez-Mendoza, Alexandro Aguilera Salgado, Chengyuan Li ... dosing of ALA presented only marginal benefit; this significantly precludes the oral application of ALA Although ALA has been marketed in Germany for treating DPN and is available as nutritional...
- 172
- 396
- 0
báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx
Ngày tải lên :
19/06/2014, 08:20
... combines training of the hand and arm into an integrated task-based simulation This unique training modality is practical and accommodates and safely challenges subjects with a range of hand impairments ... unilaterally or bilaterally and combine proximal and distal training into a single activity or train each segment separately Additionally, it presents information regarding the variability among ... 10 Day Figure Daily Average Fractionation Scores During Training Daily Average Fractionation Scores During Training Upper Panel: Fractionation Average daily fractionation for Subjects S1, S2 and...
- 10
- 506
- 0
BIPOLAR DISORDER – A PORTRAIT OF A COMPLEX MOOD DISORDER docx
Ngày tải lên :
27/06/2014, 11:20
... signaling and a elevated protein kinase A activity ( Langan & McDonald 2009 ) The calcium channels antagonists (verapamil and others) raise carbamazepine effect Magnesium, acting like a natural calcium ... increases the verapamil maintenance therapy in mania (Giannini et al 2000) This fact favors the idea that an increase in magnesium concentration is an important fact, maybe essential for the therapeutic ... of Action 57 Carla P Fonseca, Liliana P Montezinho and M Margarida C .A Castro Chapter Memantine: A New Mood Stabilizer for Treatment-Resistant Bipolar Disorders 99 Gino Serra, Giulia Serra, Alexia...
- 250
- 225
- 0
Báo cáo y học: "Systematic review of safety and tolerability of a complex micronutrient formula used in mental healt" pptx
Ngày tải lên :
11/08/2014, 15:22
... Community Health Sciences, University of Calgary, Calgary, Alberta, Canada 7Behavioural Research Unit, Alberta Children’s Hospital, 2888 Shaganappi Trail NW, Calgary, AB T3B 6A8 Canada Page of Authors’ ... Calgary, Calgary, Alberta, Canada 2Behavioural Research Unit, Alberta Children’s Hospital, Calgary, Alberta, Canada 3San Diego, California, USA Department of Agricultural, Food and Nutritional Science, ... University of Alberta, Edmonton, Alberta, Canada 5Department of Medicine, University of Calgary, and Foothills Medical Center, Calgary, Alberta, Canada 6Department of Pediatrics and Department of Community...
- 7
- 392
- 0
Báo cáo y học: " The role of recombination in the emergence of a complex and dynamic HIV epidemic" pptx
Ngày tải lên :
12/08/2014, 23:23
... found that Argentinean B and F sequence fragments in the HIV database can cover a full HIV-1 genome of each subtype, meaning that there was a potential to form any BF recombinants in Argentina and ... (01_AE and 02_AG) with ancestral lineages of subtypes A and G AIDS Res Hum Retroviruses 2007, 23:1008-1019 58 Yang R, Kusagawa S, Zhang C, Xia X, Ben K, Takebe Y: Identification and characterization ... Thailand and Myanmar (Additional file Fig S 2A) ; this occurred possibly through drug trafficking routes [26,28] Other Asian countries, for instance, Korea, Japan, and Thailand, appeared to have...
- 15
- 259
- 0
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx
Ngày tải lên :
13/08/2014, 22:22
... equations requires a large variety of rate equations and kinetic parameters, and unfortunately, such data are rarely available as a complete set Recently, our laboratory proposed a novel simulation ... disposable cells never reach a mathematical steady state Thus, a model that can tolerate long-term simulation for analyzing the pathology of human diseases should not approximate the "mathematical ... normal state of the human RBC, they are not adequate for simulating irregular conditions such as deficiencies, because they lack alternative pathways that may normally not be particularly active...
- 11
- 386
- 0
Impacts of a firms technological diversification on product diversification and performance
Ngày tải lên :
09/10/2015, 11:06
... record a patent’s primary technological class, I added supplementary information regarding all listed technological classes of a patent from the NUS-MBS patent database (data available from 1976 ... have potential applications for multiple businesses (Doz, Angelmar, and Prahalad, 1987) Argyres (1996), hence, argued that a low level of divisionalization facilitates greater coordination among ... but it has not received enough attention in strategic management literature Managing a diversified technological base could raise as many challenges and implications for a firm as managing a diversified...
- 85
- 270
- 0
Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law
Ngày tải lên :
05/09/2013, 15:28
... The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant: F = F1 + F2 (3) There exists a constant rate of bypass heat leakage ( q ) from the heat source ... heat transfer coefficient and F1 is the heat-transfer surface area of the hightemperature-side heat exchanger , β is the overall heat transfer coefficient and F2 is the heat-transfer surface area ... Ecological optimization of an endoreversible Brayton-cycle Energy Convers Manage., 1998, 39(1/2):33-44 [27] Khaliq A, Kumar R Finite-time heat-transfer analysis and ecological optimization of an endoreversible...
- 14
- 534
- 0
Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt
Ngày tải lên :
13/02/2014, 15:20
... BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; (31) Caspian Sea; (32) Gulf of Bothnia; (33) Gulf of Finland; (34) Sallvik ... were used to amplify sequences from 16S rRNA, and primers COIH 2198 (5Ј TAAACTTCAGGGTGACCAAAAAATCA 3Ј) and COIL 1490 (5Ј GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 1994) were used to obtain sequences ... distribution of E affinis Populations of E affinis in northern Russia may be more widespread (1) St Lawrence estuary, Canada; (2) St Lawrence marsh, Canada; (3) Saguenay River, PQ, Canada; (4) Lac St Jean,...
- 14
- 491
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
Ngày tải lên :
18/02/2014, 08:20
... oxidase complex was clearly demonstrated [10–12], but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14] A higher-order organization of the respiratory chain complexes ... molecular mass calibration markers included thyroglobulin (670 kDa), apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), conalbumin (78 kDa), albumin (66 kDa), and b-lactoglobulin ... the dimerization of the complex Such a structural rearrangement of the bc1 complex may also be associated with a concomitant rearrangement of the bound assembly factors These considerations become...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
Ngày tải lên :
19/02/2014, 05:20
... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... 3168–3176 Takahashi S, Mansfield Matera KM, Fujii H, Zhou H, Ishikawa K, Yoshida T, Ikeda-Saito M & Rousseau DL (1997) Resonance Raman spectroscopic characterization of a- hydroxyheme and verdoheme complexes ... and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, but not identical, to those of the ascorbate reaction, which was mainly...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... essential for activity of complex I in mammalian mitochondria Proc Natl Acad Sci USA 96, 4354–4359 10 Marques, I., Duarte, M & Videira, A (2003) The 9.8 kDa subunit of complex I, related to bacterial ... served as another identification of the complex at the position of the histochemical stain in the left panel Antisera against the SDHC subunit of complex II and against the Rieske protein of complex...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... N A A A A A A A A A A S S S S S S S S S S C C C C C C C C C C T T T T T T T T T T T T T T T T T T T T N N N N N N N N N N AthalianaB 159 PativumB 159 SoleraceaB 159 159 NtabacumB A. thalianaA...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
Ngày tải lên :
20/02/2014, 23:20
... mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic activity about ... Kinetic parameters of wild-type and mutant E1s determined by the DCPIP assay Pyruvate ThDP kcat (s)1) Wild-type E1aF26 6A E1aR26 7A E1aD27 6A E1aY28 1A E1aR28 2A E1aS283C E1aY28 1A/ R28 2A/ S28 3A E1aY28 1A/ R28 2A ... eukaryotic PDH and BCDH complexes ODPA and ODPT, E 1a chain of PDH complexes with heterotetrameric E1 (a2 b2); ODBA, E 1a chain of heterotetrameric E1 (a2 b2) of BCDH complexes mutant was a replacement of the...
- 10
- 459
- 0