pc12 cells as a model for studies of regulated secretion in neuronal and endocrine cells

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Ngày tải lên : 22/03/2014, 17:20

... S17 cells for intravenous and intra-femoral transplantation into sub-leth- New advances in human hematopoiesis from human ESCs ally irradiated NOD ⁄ SCID mice (treated with an antibody against ... factors GATA-1 and GATA-2 was observed from days and of differentiation, coincident with the onset of CD34 and SCL expression on days and 4, respectively Additionally, colony-forming cells also ... to induce hematopoietic differentiation of hESCs Expression of CD34 was found in all cases from day and peaked at day 18, matching the peak of activity of colony-forming cells Co-culture of hESCs...

12
550
0

Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx

Ngày tải lên : 09/08/2014, 23:20

... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... Justification and strategies for expansion of snake genomics Research incorporating snakes as model systems is becoming increasingly popular and diverse in its breadth of topics The availability of the ... comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family...

8
410
0

Báo cáo y học: "Vasculature deprivation – induced osteonecrosis of the rat femoral head as a model for therapeutic trials" ppsx

Ngày tải lên : 13/08/2014, 23:20

... 181:479-488 129 Yamashita T, Asano K, Takahashi N, Akatsu T, Udagawa N, Sasaki T, Martin TJ, Suda T: Cloning of an osteoblastic cell line involved in the formation of osteoclast-like cells J Cell ... Pressure Taking for granted the accuracy of the paradigm of the pathogenetic role of vascular deprivation and anoxia in bringing about necrosis of the femoral head, revascularization and oxygenation ... migration of osteoblasts and activation of osteoclasts So far so good; but medication with VEGF would also enhance the removal of dead bone and increase the formation of a mechanically weak intramembranous...

14
357
0

Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx

Ngày tải lên : 24/03/2014, 00:21

... HERG PAS domain does not bind a ligand [11], both the FixL PAS domain and PYP are activated by ligands; in FixL, oxygen binding at the heme binding PAS domain controls the activity of a histidine ... entrance of the FixL ligand cavity, Arg220, that binds a heme propionate group, is replaced by Thr in all AhR (Thr343 in mAhR), except for human AhR and AhR-1C.E that have isoleucine and leucine, ... limitations in today's modelling and prediction techniques, the model presented here has to be considered only an approximate and probably incomplete picture of the ligand binding domain of AhR and of...

6
569
0

Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx

Ngày tải lên : 08/08/2014, 23:21

... place after treatment and included both a retrospective pretreatment and a follow-up rating Finally, the research staff obtained a list of medications before and after treatment in order to ascertain ... examine for any associations between the demographic variables and the total score of the BPRS, BSI, and Client Observation Scale General linear model (mixed model analysis of variance (ANOVA)) was ... informed consent and testing were initiated and completed between and 24 h from the beginning of treatment (that is, from the subject's examination by a psychiatrist and formulation of a treatment...

12
477
0

Báo cáo hóa học: " The Reflux Disease Questionnaire: a measure for assessment of treatment response in clinical trials" pdf

Ngày tải lên : 18/06/2014, 22:20

... trial case record form for each visit and graded = none, = mild, = moderate, and = severe Translation and cultural adaptation The RDQ was translated into Norwegian and Swedish according to international ... little better was defined as +1 to +4, while much better was defined as +5 to +7 Other assessments At both clinic visits, a clinical trial assessment interview and a physical examination were conducted ... RDQ scales and physician symptom severity ratings for regurgitation, heartburn, and dyspepsia at baseline and at visit A positive correlation was found between physician severity ratings and RDQ...

6
462
0

Báo cáo hóa học: "Research Article An Empirical Model for Probability of Packet Reception in Vehicular Ad Hoc Networks" pdf

Ngày tải lên : 21/06/2014, 22:20

... a probabilistic radio wave propagation A deep mathematical analysis was proposed in [12] that studies a probabilistic radio wave propagation and the capturing eﬀect The complexity of a joint consideration ... “Non-saturation and saturation analysis of IEEE 802.11e EDCA with starvation prediction,” in Proceedings of the 8th ACM International Symposium on Modeling, Analysis and Simulation of Wireless and ... pursue a hybrid approach: by applying linear least squares curve ﬁtting techniques to an abundance of simulation traces, we obtain an analytical term for the probability of reception Additionally,...

12
330
0

Franchising as a modern contractual realization of distribution (Particularly in Slovakia)

Ngày tải lên : 10/12/2016, 17:14

... advantages and disadvantages, franchisees advantages and disadvantages and consumers’ advantages and disadvantages Chapter explains the contractual issues of franchising agreement It states the main ... at local, national and international organizations and structures operating in the affected areas, market analysis, purchase, marketing and advertising, advice on choosing franchisee and placement ... franchisor and its trained staff and can use franchisors patents and registered trademarks, Assistance in starting, running; franchisor would also be able to offer for a franchisee a training that will...

49
309
0

Multi-beneficial for mitigation of climate change in Vietnam and Indochina countries by development of biomass energy project

Ngày tải lên : 18/03/2015, 13:20

... ffect of supporting m aterial on increased fresh w e ig h t and root length of Jatropha plant cultured in vitro at day 42 Table Effect of supporting material on leaf area and increase dry weight of ... Dioxins analysis in soil of Jatropha curcas plantation site Dr Isao Watanabe (Ehime Univ.), Representative o f CEM 11:20-11:40 Group2 Determination of heavy metals in soil of Jatropha curcas plantation ... ' reclamation of waste organic materials 2013/1 Other candidates of oil plants i JOINT COORDINATING COMMITTEE (JCC) MEETING Hanoi, January 7, 2013 Study of Jatropha curcas micropropagation Nguyen...

122
403
1

Ion channeling studies of defect formation in gan and related materials

Ngày tải lên : 16/09/2015, 08:31

... termed as stacking fault (shown in Fig 4.4) In case of a stacking fault, an internal surface (just like a crystal surface) exists As the beam passes through the fault area with a monolayer of atoms ... crystal travelling along speciﬁc planar and axial directions These movies are helpful in visualizing planar and axial channelling phenomenon in crystals It may be noted that motion of planar and axially ... 9: Planar and axial proton channelling movies are produced which show variation of phase-space coordinates of planar channelled and space-space coordinates of axially channelled MeV protons in...

124
442
0

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Ngày tải lên : 09/08/2014, 01:23

... on pre-activated T cells in pathogen-induced chronic inflammatory joint diseases inflamed joint activated and memory T cells can pass endothelial barriers TLR ligands can activate T cells independent ... joint diseases Any diseases inflammation will cause the induction of chemokine and cytokine production in several tissue-associated cells in the joint, including fibroblasts, macrophages and dendritic ... cells from TLR-2-/- mice, isolated mature resting B cells, marginal-zone B cells and, above all, macrophages In addition, these data strongly argue against a contamination of the purified T cells...

14
505
0

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Ngày tải lên : 09/08/2014, 03:24

... Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T: Organ-specific autoimmune diseases induced in mice by elimination of T cell subset I Evidence for the active participation of T cells in natural ... in humans One group has reported the appearance of Th3 cells in patients with multiple sclerosis following oral administration of myelin basic protein [28] Human Tr1 cells suppressed an alloantigen-induced ... N, Asano M, Itoh M, Toda M: Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor-chains (CD25) Breakdown of a single mechanism of self-tolerance causes various autoimmune...

6
408
0

báo cáo khoa học: "Backstep scanning ion conductance microscopy as a tool for long term investigation of single living cells" pptx

Ngày tải lên : 11/08/2014, 00:22

... of frame A from frame J (Fig 1) Here green areas denote areas without any changes in height, red areas correspond to areas of increasing height and blue areas represent areas of decreasing height ... position during the time of observation Again, red areas denote areas of increasing height and thus novel cell locations whereas blue areas represent areas of decreasing height corresponding to previous ... clarity) (B) Difference image between first and last scan Lateral scale bars in (A) and (B) represent μm (C) Plots of the velocities of each of the three points of observation as defined in (A) ...

9
291
0

Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot

Ngày tải lên : 13/08/2014, 23:20

... comparable to other data sets analysed, multiple data points for a species were replaced by a single data point calculated as the average value of body weight and the average value of BMR for ... strictly increasing The second prediction is that the above slope approaches BMRv = avM0.86, βn as M increases (and y increases) and approaches β1 as M where av is a constant Finally, the overall ... estimated as the midpoint of the values of ki plus the midpoint of the values of bi because values of ki are not available for certain tissues For scaling of the brain and the epithelial tissues of...

8
356
0

The roles of rac1 and syncollin in regulated exocytosis insulin secreting INS 1 cells as a model

Ngày tải lên : 16/09/2015, 17:11

... protein kinase II, protein kinase A and protein kinase C, respectively These protein kinases phosphorylate a variety of proteins in β -cells, which participate in the cascade of stimulation of insulin ... Constitutively active and dominant inhibitory form of Rho GTPase The mutations of a number of conserved amino acids in Ras superfamily proteins decrease the intrinsic and GAP-stimulated GTPase activity, allowing ... progressive intragranule acidification, loss of clathrin coat, and formation of hexameric insulin crystal Matured secretory granules containing insulin and C-peptide are kept in intracellular storage...

140
249
0

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Ngày tải lên : 21/02/2014, 03:20

... searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes ... separated in a training set constituted of 48 samples of the cell line A and a test set composed of 30 spectra of cell line A and cell line B The training set was the only one used for model calculations ... greatest part of the original data information In the second part of our work, we focused on the biochemical information available in infrared spectra, and we found that infrared spectra of resistant...

6
555
0

Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

Ngày tải lên : 06/03/2014, 00:20

... other hand, the fine and timely analysis of the amyloid architecture of IB proteins [14,15] has led to the use of these underestimated bacterial aggregates as intriguing models for the analysis of ... absorbance spectra of CR in the presence and absence of IBs showing in all cases the characteristic amyloid band at 540 nm; (G) HET-s PFD IBs stained with CR and observed at 40· magnification and ... Galactosidases [7,34], reductases [7], oxidases [35], kinases [36], phosphorylases [37] and aldolases [38] are just some examples of the enzymes used in aggregated form to catalyse specific reactions,...

9
432
0

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Ngày tải lên : 06/03/2014, 09:22

... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... nuclear localization of viral nucleic acids in nondividing host cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes ... cofactor of ASF ⁄ SF2 [39] Splicing acceptor sites A4 a, A4 b and A4 c Rev mRNAs are spliced at all three of these acceptor sites (Fig 1) The RNA binding proteins Tat and Rev are key regulators for...

10
434
0

Báo cáo khoa học: Identiﬁcation of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Ngày tải lên : 06/03/2014, 22:21

... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... identiﬁed in a number of solid tumors, including renal carcinomas and, particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...

13
563
0

Blackwell Science, Ltd Group breeding dramatically increases reproductive success of yearling but not older female scrubwrens: a model for cooperatively breeding birds? ppt

Ngày tải lên : 14/03/2014, 16:20

... first egg was laid was used as the measure of the beginning of the breeding season for a female The ‘end of the breeding season’ was estimated as the date of failure or fledging of the final attempt, ... in the Gardens and in the adjacent Canberra Nature Park (c km2 ), and there was dispersal both into and out of the Gardens The Gardens occupy an area of 40 ha, of which 27 are planted with native ... SPSS 9·0 (SPSS Inc 199 9a) was used to select one season if there were data for more than one season Given that there was only one season for an individual as a yearling and one as an older bird,...

16
337
0