particular if at the acquisition date the acquired business is party to an operating lease contract under favourable or unfavourable terms compared with market conditions the acquirer shall recognise an intangible asset or a provision respectively
... that denotes the physical, emotional changes turning "a woman" into "a mother" This is also a sensitive period for mother's and newborns health According to World Health Organisation, there is ... husbands take care of their wives and babies afterbirth 4.1.1.4 Source of Postnatal care information Women at both urban and rural areas can access easily with many sources of PC information There ... EPIDATA 3.1 was used for data entry SPSS soft ware was used for data analysis Descriptive and frequency analysis, T test, Chi square test, OR and 95% confidence interval were used The statistical...
... from the table dt The DataTable to convert tothe array rowCount The number of rows to export tothe array startRow The row number of the first row to export fields A string array containing the ... specified row if (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding tothe values in the columns and...
... analysis is taken into account SaSTP has been shown to dephosphorylate three different substrates These are a family II inorganic pyrophosphatase, a response regulator CovR, and a purine biosynthesis ... contained 0.2 m magnesium acetate, making Mg2+ the most likely candidate The coordination is octahedral, which is typical for Mg2+ [35–37] and the ˚ coordinating distances (1.83–2.47 A) are close ... to SaSTP As our structure shows, this sequence does indeed bind metal ion at M3 – and the largest change they report in all their mutants at this site is less than a factor of four greater than...
... that although gelsolin can be activated by low pH in an apparently similar manner to that induced by calcium, important differences exist The most striking difference is that the calcium ÔlatchÕ ... excitation at 280 nm The parameters Kd (apparent dissociation constant) and Amax (maximum effect) were calculated by nonlinear fitting of the experimental data points as for ELISA (Eqn 1) or by ... parameters (apparent dissociation constant Kd and the maximal binding Amax) were determined by nonlinear fitting: A ¼ Amax  ½L=ðKd þ ½LÞ ð1Þ where, Aisthe absorbance at 405 nm and L the ligand concentration,...
... eukaryotic carbohydrate metabolism integrating other metabolic pathways that are associated with glycolysis and the PPP PPP activity isa regulator of normal lifespan of S cerevisiae and C elegans Much ... available as Additional data file Additional data files Additional data are available with this article online Additional data file contains details of the C elegans experiment Additional data ... mother cells per generation (b) For the lifespan analysis of C elegans the parental and the F1 generation (left panel, 117 wild-type and 80 tpi-1 RNAi animals were analyzed) orthe F1 generation...
... FC analyzed and interpreted the data LM, SL and TB made a substantial contribution totheacquisition of clinical data and the follow-up of the patients All authors read and approved the final ... transmitting the 1858T allele The plan was to test the hypothesis for RF+ RA; analysis for all RA and RF- RA were provided for the discussion to reach statistical significance (P < 0.05) Our sample ... PCR-restriction fragment length polymorphism The sense and antisense primers were, respectively, 5'-GATAATGTTGCTTCAACGGAATTT-3' and 5'-CCATCCCACACTTTATTTTATACT-3' The PTPN22-1858C/T transition at codon...
... that the waveform in Fig S3D (Figs and here) is misaligned and that temperature rises in anticipation of mealtime at least an hour earlier than this figure suggests The data therefore appear to ... while rats and mice eat for an hour or so and then take a post-prandial pause before eating again Errors of these types are not mutually exclusive (e.g., some waveforms appear misaligned, and others ... locomotor activity, and therefore temperature, if high prior to mealtime, normally remain elevated at least through the expected mealtime), the data may be misaligned, and the waveforms shifted to...
... the theatre Raymonde Moulin observes that acontract signed witha major gallery has a commercial value and that, in the eyes of the amateurs, the dealer isthe guarantor of the quality of the ... Each major gallery was an avant-garde gallery at some time or other, and it is that much more famous and that much more capable of consecrating (or, which amounts tothe same thing, sells that ... a brake, and above all Grasset, once a ’great’ publishing house, now absorbed by the Hachette empire, and Gallimard, a former avant-garde firm that has now attained the peak of consecration and...
... the final, or manifestation, stage of SAR, the plant responds to normally virulent pathogens in a resistant manner [3] Manifestation of SAR is associated withthe expression and activity of a set ... transport to distant leaves [21] These data and the fact that DIR1 encodes a putative lipid transfer protein led tothe hypothesis that DIR1 is involved in long distance signaling and may chaperone ... 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGTGAGCAAGGGCGAGGA and reverse primer 5’-GGGGACCACTTTG TACAAGAAAGCTGGGTTACTTGTACAGCTCGTC CATGCC PCR products were recombined into entry vector pDONR221 using a...
... overrepresented among patients who died at 28 or 90 days, and they also predisposed to MODS and ARDS respectively Likewise, 6A was associated with ARDS, and 1A was associated with MODS By contrast, 6A3 and ... functional differences between variants at SP -A1 and SP -A2 are poorly understood [14,49,50] Variants aa50 (SP -A1 ) and aa91 (SP -A2 ) are located in the collagen region These changes may affect the ... susceptibility to CAP Haplotypes 6A and 6A to 1A are associated with development of ARDS, while 1A and 1A1 0 are associated with MODS in patients with CAP The variant SFTPD aa11-C leads to decreased SPD...
... clerosis and AngII, whether up-regulation of Cx43 can be antagonized by AT1 antagonists or whether suppressed smooth muscle cell proliferation and migration by AT1 antagonists are mediated through ... imaging software Statistical Analysis Data are presented as mean ± SD Data of multiple groups were analyzed by one-way analysis of variance Means between two groups were comparedwitha two-tailed Student ... or incubated with anti-Cx43 monoclonal antibody (Zymed Laboratories Inc, Carlsbad, CA) or anti-Cx40 monoclonal antibody (Alpha Diagnostic International Inc, San Antonio, TX) ata dilution of...
... the advantage of rotational and axial stability [3] A normal cementation has the disadvantage in comparison withthe partial cementation that all cement debris have to be removed from the femoral ... extremity, the patient should be rather considered as a candidate for a resection arthroplasty and not for a spacer implantation For prevention of any spacer dislocation due toan insufficient fixation ... organism After infection eradication, the spacer head has been removed and a metallic head withan acetabular cup implanted This procedure offers a stable fracture treatment and facilitates the...
... summary, analyzing the indicators suggests that, due tothe impact of the world’s economic crisis and having to pay the corporate income tax for the first year, the Company’s business performance ... of the Board of Directors The Vice Chairman is also Executive Director The Company’s Headquarter is located at 4 8A Lang Ha, Dong Da District, Hanoi Head office isat 381 Doi Can Ward, Lieu Giai, ... have It also allows an organization to predict costs with more certainty than does merit pay, and avoids the difficulties associated with performance evaluation Due to budgetary limitations and...
... hand “I know this is difficult and there‟s nothing I can say to make this any easier I can‟t explain why this happened the only thing I can is ask you to tell me what happened That‟s going to ... Renee‟s hazzle eyes were large and pleading and uncharacteristically threatening tears “It‟s sort of a reaffirmation of life I want to start over and prove to myself that I can something this big without ... storage and flight attendants walked around aimlessly but that was it Then the engines turned on Twenty minutes later the pilot came on and said that they were preparing for take off (What the...
... that it makes the language-learning tasks appear manageable A syllabus isan implicit statement of view on the nature of what is taken to be the most important aspect of language learning A syllabus ... thank all my colleagues and my dear students atthe National Teachers Training College for their participation, assistance and support for this thesis ABSTRACT This study is intended to deal with ... taught Nunan (1988) shares the same view that a syllabus isa specification of the content that isto be taught in a language program and the order in which it isto be taught All or any of the...
... to state that beside the roles of a general English teacher that are mentioned above such as an instructional expert, a manager, a counselor, a facilitator, an organizer, an evaluator, a curriculum ... Language problems It isthe fact that the reader’s knowledge in the foreign language and that in the native speakers are not the same In other words, the native languages and the target language ... choosing relevant published material, adapting material when published material is not suitable Another role that the ESP teachers plays is that they should act as an evaluator which involves the testing...
... important for the readers to have something to look atis eye-caching and relevant tothe task in hand There are many advantages of using visual aids in a reading lesson that the teacher can ... place in class 1 6A with Unit 1-Part Four, the reading texts in this unit are all about the Hawaiian Islands such as Water Sports in Hawaii, and Natural Disasters in Hawaii and Hawaiian Traditions, ... the graphic form and understand the relation between the writing and the meaning It means that after reading, students can master grammar structures, words, pronunciation etc and can understand...
... social communication and isthe efforts by the participants to avoid losing others face Facework entails both avoidance strategies (e.g., avoiding unsafe topics or violating anothers territory) and ... that the conversation is working easily with small talk questions and this kind of conversation above is called small talk A small talk is defined as an everyday conversation about everyday matters, ... knew his American friend would disagree The Italian wanted to involve the American in a lively discussion The American, rather than openly disagreeing, said, Well, everyone is entitled toan opinion...