park whose safety depends upon their knowledge of the minds of wild animals this volume is dedicated as a token of appreciation and regard
Inside the minds leading consultants industry leaders share their knowledge on the art of consulting
... harder is the whole theory around people – your workforce and what their professional desires and goals in life are and what their emotional attitudes are We talk a lot about the Generation X and the ... remember that there is a really creative part to this business That we had a certain point of view a year ago doesn’t mean that point of view won’t change as we increase our learning and adjust our ... with the trends in their verticals, so that they can offer innovation and insight Another essential part of this ability to provide insight is understanding what the hot points are and what the...
- 281
- 202
- 0
Inside the minds leading consultants industry leaders share their knowledge on the art of consulting
... harder is the whole theory around people – your workforce and what their professional desires and goals in life are and what their emotional attitudes are We talk a lot about the Generation X and the ... remember that there is a really creative part to this business That we had a certain point of view a year ago doesn’t mean that point of view won’t change as we increase our learning and adjust our ... with the trends in their verticals, so that they can offer innovation and insight Another essential part of this ability to provide insight is understanding what the hot points are and what the...
- 281
- 184
- 0
báo cáo khoa học: " Knowledge of AIDS and HIV transmission among drug users in Rio de Janeiro, Brazil" doc
... Multidimensional scaling (MDS) is a method aimed at displaying statistical information in a low-dimension geometrical space as a clearly discernable visual presentation, used for assessing contrasts and ... engaged in treatment for drug abuse in the last 30 days The minimum sample size was defined in advance after the calculation of statistical power of hypothetical multivariable analyses that took ... Initially, an exploratory analysis of socio-demographic characteristics, drug consumption patterns, and sexual behaviors was carried out Knowledge on AIDS and HIV transmission modes was evaluated...
- 10
- 270
- 0
A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation
... and Disadvantages of Microstrip Antennas It is actually the last advantage in the list above that makes microstrip antennas so popular today Many characteristics of a single microstrip patch antenna ... every façade of antenna communications From the battle field to commercial enterprises, the microstrip antenna is fast replacing many conventional antennas The advantages and disadvantages of the ... and the cavity model This chapter details the study of the various models used in the analysis of microstrip antennas, and presents the main characteristics and assumptions made in the use of the...
- 104
- 329
- 0
RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK IN PHU THO PROVINCE AS a BASIS FOR PLANNING AND CONSERVATION WORK
... Representatives are often families of Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation ... such as Fagaceae, Camellia sinensis The secondary forest of restoration after exploitation: species are often Castanopsis armata, C tessellata, Lithocarpus elegan, Aglaia gigantea, Vatica odorata, ... rice-leaf weeds such as Thysanolaena maxima, Saccharum arundicaceum, Miscanthus nepalensis, Miscanthus japonica, Miscanthus japonica, Saccharum spontaneum, Sasa spp., Neyraudia reynaudiana, etc...
- 27
- 532
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... to G-quadruplex DNA (A) EMSA was performed with EWS (lanes and 4) and 32P-labeled ETS-1 (lanes and 4) or ssDNA L (lanes and 2) (B) EMSA was performed with EWS (lanes 2, and 6) and 32P-labeled ... (lanes and 4), dsHtelo (lanes and 6) or ssDNA S (lanes and 2) The structures of DNAs used as probes are indicated above each lane The DNA–protein complexes were resolved by 6% PAGE and visualized ... ACA G) and EWS reverse d(CGC TCG AGT CAC TAG TAG GGC CGA TCT CTG C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC...
- 11
- 786
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data ... observational study is underway in Israel to assess the obstetric anesthesia workforce supply and work load demand ratio, based on the OAAI, and to correlate this with quantifiable measures of adequacy ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per...
- 14
- 610
- 0
Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt
... 53 Agha CA, Ibrahim S, Hassan A, Elias DA, Fathallah-Shaykh HM: Bevacizumab is active as a single agent against recurrent malignant gliomas Anticancer Res 2010, 30:609-11 54 Bergsneider M, Sehati ... trials are indicated with a blue star, the vaccine therapy trials with a red circle, and the combined cellular and vaccine therapy trials with a white triangle Cellular Therapy Trials The adoptive ... Trials Immunization of patients relies upon activation of endogenous immune cells and is categorized as a form of active immunotherapy In Table (upper half) we list cell-based vaccination trials...
- 10
- 589
- 0
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
... P, Ahmad A, Mandal D, Senapati S, Sainkar SR, Khan MI, Ramani R, Parischa R, Kumar PAV, Alam M, Sastry M, Kumar R: Angew Chem Int Ed 2001, 40:3585 14 Ahmad A, Senapati S, Khan MI, Kumar R, Ramani ... biomass-based reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica A Juss was surveyed, and samples ... the biofabrication of silver nanoparticles [4], but no reports are available about their potential in biofabrication of gold nanoaparticles This strain is largest among the Aspergillus spp and...
- 7
- 261
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI 41768, The Nora Eccles Treadwell Foundation, and the Arthritis Foundation-Southern ... Arthritis Research Vol No Horwitz et al can serve as a therapy for autoimmune diseases such as systemic lupus erythematosus (SLE) This T-cell-based therapy could also be used to prevent graft ... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and...
- 6
- 408
- 0
Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx
... HCD increased plasma SAA as seen by others [20], and plasma CD14 was induced (Figure 8A) L-alanine:2-oxoglutarate aminotransferase, ALT Although the consequences of the increases in SAA and CD14 ... discussion 315-6 Shimada H, Hasegawa N, Koh H, Tasaka S, Shimizu M, Yamada W, Nishimura T, Amakawa K, Kohno M, Sawafuji M, Nakamura K, Fujishima S, Yamaguchi K, Ishizaka A: Effects of initial ... respects As detailed later, removal of LPS from plasma was not affected by diet, and, while the plasma SAA was increased by HCD alone, the level to which it was induced by LPS was similar to the The...
- 11
- 281
- 0
Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx
... 2001 82 still have to be used because this is not yet a standard tool in the available GIS-packages The visualisation of the disease rates on digital maps can be misleading because the eye tends ... identifying the location of the case farm and all farms at risk within a specified area of the outbreak Buffer zones can be drawn around those farms as shown in Fig and with a link to tables of the addresses ... Norway Digital maps of Norway are provided and can be purchased from the National Map Department of Norway The geographic data consisting of themes of each geographical feature are complete for the...
- 7
- 341
- 0
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... data AM conceived and coordinated the study, analyzed the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... cold PBS and lysed in RIPA buffer (50 mM Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG ... MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected...
- 15
- 470
- 0
Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx
... d-siRNAs (red) The data are compared to a simulated, two-dimensional Normal distribution of the stochastic noise (blue) The estimated standard deviation of the noise distribution is based on the ... (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative signaling ... information The experimental noise distribution was estimated using the distribution of the deviations of the duplicated F values The data distribution fdata(x) was derived from the histogram of the...
- 11
- 286
- 0
performance of robust controller for dfim when the rotor angular speed is treated as a time-varying parameter
... reads as (21) (27) where is the nominal speed, is the variation of the rotor angular speed around its nominal value, and is the normalizing factor that maps the uncertain element into a normalized ... , as well as the stator voltages , and the control errors , This may cause a large tracking error for the controlled system since the stator voltages and are the input disturbances outputs and ... designed for a frozen value of was not completely guaranteed for other rotor angular speeds An important point that is needed to be emphasized in this particular case is that the performance of the controller...
- 10
- 336
- 0
An investigation into structure and meaning of geological textbooks as a genre in English and Vietnamese = Nghiên cứu cấu trúc và ngữ nghĩa các giáo trình địa c
... analysis and the framework of systemic-functional grammar As a way of start, we will take a look at the notions of genre, and genre analysis made as they are understood by scholars such as Jamieson ... generic analysis aims to illuminate rather than classify 15 This analysis offers a way of studying discoursal development over time that is detachable from an analysis of an individual event or / and ... English and Vietnamese To compare the generic structure and linguistic features of the five Introduction Parts and Body Parts, we take the English language as the base language and Vietnamese as...
- 661
- 1,263
- 2
An investigation into structure and meaning of geological textbooks as a genre in English and Vietnamese = Nghiên cứu cấu trúc và ngữ nghĩa các giáo trình địa c
... analysis and the framework of systemic-functional grammar As a way of start, we will take a look at the notions of genre, and genre analysis made as they are understood by scholars such as Jamieson ... generic analysis aims to illuminate rather than classify 15 This analysis offers a way of studying discoursal development over time that is detachable from an analysis of an individual event or / and ... English and Vietnamese To compare the generic structure and linguistic features of the five Introduction Parts and Body Parts, we take the English language as the base language and Vietnamese as...
- 661
- 715
- 0
Frequency of Routine and Flooding-stage Observations for Precise Annual Total Pollutant Loads and their Estimating Method in the Yodo River
... one of the environmental standard items analyzed in marine areas in Japan Suspended solids (SS) was measured using the above-mentioned glass-fiber filter, and chlorophyll -a was analyzed by the ... traveling time of river water from their main pollutant sources and the lack of uniformity of rainfall distribution in the broad catchment It was particularly evident that the values and peak ... big flooding-stages, cooperative water discharge occurred through opening of the weir at Lake Biwa and the gates of the Amagase Dam Theses discharge brought high pollutant loads and a high flow...
- 9
- 572
- 0
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan
... Osaka, Kobe, Hiroshima, and others Therefore, it is considered that a large amount of pollutants runs into the sea from the urban as well as industrial areas As the area around the Seto Inland ... increased amount of SS to the increased amount of Chl .a was higher than that of the algae Increased amount of SS were higher in the cases of high nitrate concentration - 117 - Journal of Water and ... uptake and transition to the bottom due to the increase of pH Other materials, such as heavy metals, were similar, and their concentration decreased at the reservoir Water quality of the leachate...
- 10
- 717
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ