oxidative stress in diabetes mellitus s a moussa

báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

Ngày tải lên : 19/06/2014, 22:20

... Helkala EL, Laakso MP, Hanninen T, Hallikainen M, Alhainen K, Soininen H, Tuomilehto J, Nissinen A: Midlife vascular risk factors and Alzheimer&apos ;s disease in later life: longitudinal, population ... purposes) Journal of Neuroinflammation Open Access Review The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer&apos ;s disease Brandy L Wilkinson* and Gary E Landreth Address: Alzheimer ... peroxidation and oxidative imbalance: early functional events in Alzheimer&apos ;s disease. J Alzheimers Dis 2004, 6:171-175. 26. Markesbery WR: Oxidative stress hypothesis in Alzheimer&apos ;s disease....

12
413
0

Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt

Ngày tải lên : 30/03/2014, 10:20

... GGCTCTGGAACTGAATAAAGCGAC pes1 A2 reverse GTCCCATATATCCGCTTGCAATCT pes1 A4 forward TCTGACTCCGTCGATAGCTAGCAT pes1 A4 reverse CCAGATCCTCACGACTGATAAGCTC pes1 C2 forward GAGATCTAGATACCCATGCAGCCCTGTC pes1 C2 reverse ... GATATCGAATTCGCCTCAAACAATG Nested forward GAGACCTAGGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT Nested reverse GAGACCGCGGAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGA NRP synthetase in Aspergillus fumigatus ... pes1 in pro- tecting A. fumigatus against oxidative stress. Semiquantitative analysis of pes1 expression has conﬁrmed that the gene is present, and differentially expressed, in four strains of A. ...

16
361
0

báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx

Ngày tải lên : 19/06/2014, 22:20

... G, Aliev G, Irai K, Takeda A, Balraj EK, Jones PK, Ghanbari H, Wataya T, Shimohana S, Chiba S, Atwood CS, Petersen RB, Smith MA: Oxidative stress is the earliest event in Alzhe- imer&apos ;s disease. ... After 15 min, the reaction was stopped and absorbance immediately read at 450 nm. Oxidized pro- tein standards, internal controls and blanks were always assayed at the same time and in the same ... the relationship between brain inflammation responses and oxidative stress has not yet been clearly delineated in AD. For example, its is possible to consider these two events as elements of the same...

9
490
0

Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"

Ngày tải lên : 26/10/2012, 09:07

... inflammation after anoxia. The Figure 2 shows activities of AS, AL and arginase in the study. AS and AL activities increased in all the three brain regions significantly in anoxia suggesting ... stress in anoxia and reperfusion and suggests a possible role for anti oxidants in preventing neuro- degeneration in anoxia and reperfusion injuries to brain. The increased arginase and sustained ... (20). Apart from NO synthesis L-arginine may also serve as a substrate for glutamate formation and may also provide increased substrate for arginase (50). No significant changes in the activity...

8
622
0

Tài liệu Báo cáo khoa học: Oxidative stress in the hippocampus after pilocarpineinduced status epilepticus in Wistar rats doc

Ngày tải lên : 19/02/2014, 16:20

... dismutase and catalase activities in the hippocampus of adult rats after pilocarpine-induced SE Table 1 shows superoxide dismutase and catalase activities in the hippocampus after seizures and SE ... Oxidative stress in the hippocampus after pilocarpineinduced status epilepticus in Wistar rats Rivelilson M. Freitas, Silva ˆ nia M. M. Vasconcelos, Francisca C. F. Souza, Glauce S. B. Viana and ... data suggest that the hippocampus does not use superoxide dismutase as the major free-radical- scavenging system [9,30]. It probably uses other scavenging systems (catalase and GSH). Pilocarpine-induced...

6
480
0

Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf

Ngày tải lên : 07/03/2014, 12:20

... receptor-based mechanisms are modulated by [Ca 2+ ] e : (a) the Ca 2+ -sensing receptor is activated by millimolar changes in [Ca 2+ ] e , and is widely distributed in mammalian tissues including brain ... mechanisms may act alone or in concert with nonselective Ca 2+ channels in producing signiﬁcant excitotoxic Ca 2+ increases following ischemic insults. TRP channels as candidates for paradoxical Ca 2+ -increases TRP ... latter study the authors also demonstrated that the increase in superoxide radical formation is predominantly associated with extramitochondrial phospholipase A( 2) (PLA 2 ) activation, and it does...

18
549
0

Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf

Ngày tải lên : 15/03/2014, 23:20

... and outlined their relevance as signiﬁcant con- trolling steps of energy metabolism in parasites subjected to oxidative stress. Abbreviations AcCoAS, acetyl-coenzyme A synthetase; Cat, catalase; ... ﬂuxes in live parasites. Results Kinetic characterization of EhPFOR in amebal extracts PFORs in several anaerobic parasites have been found attached to plasma and hydrogenosomal membranes [20,21], ... acetyl-CoA. Basal activity with NADH and the extract was always subtracted. Complete inhibition of the ADH activity with pyrazole was deter- mined separately in the ADH assay. Acetyl-CoA synthetase activity...

14
420
0

Báo cáo khoa học: Fasting-induced oxidative stress in very long chain acyl-CoA dehydrogenase-deﬁcient mice pdf

Ngày tải lên : 15/03/2014, 23:20

... genes regulating peroxisomal and microsomal oxidation pathways was analyzed by RT-PCR. In addition, glutathione peroxidase and catalase activities, as well as thiobarbituric acid reactive substances, ... mirrors the effects observed for GPX and catalase activities, thus indicating that a diet based on MCTs raises the risk of ROS production. The TBARS concentration was strongly increased after fasting ... skeletal myopathy also occur in long-chain fatty acid oxidation defects [4]. During these catabolic situations, long- chain fatty acids cannot be oxidized, and accumulate in tissues as long-chain acyl-CoAs and...

10
381
0

Báo cáo hóa học: " Oxidative stress in NSC-741909-induced apoptosis of cancer cells" potx

Ngày tải lên : 18/06/2014, 16:20

... Furusawa S, Kimura E, Kisara S, Nakano S, Murata R, Tanaka Y, Sakaguchi S, Takayanagi M, Takayanagi Y, Sasaki K: Mechanism of resistance to oxidative stress in doxorubicin resistant cells. Biol ... kinase phosphatases [3]. MAP kinase phosphatases (MKPs) are a group of dual-specificity phosphatases that inactivate MAPKs by dephosphorylating their threonine and tyrosine residues. At least ... pro-inflammatory cytokine signaling cascade, and the delayed and sustained activation is mediated by ROS [45], which inactivate MAP kinase phosphatases by reacting with catalytic cysteine and causing...

10
576
0

Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx

Ngày tải lên : 07/08/2014, 17:22

... Western blotting detection system (Amersham). Statistical analysis Data were expressed as mean ± SD. For comparison of means, Student s t -test was performed using SPSS 9.0 (SPSS Inc., USA) statistical ... 5'-TTACTTTCTTGTTCAGCGAC CGA-3' and antisense 5'-C ACCTTCGTATAGAATGTCCG CA-3', Cu/Zn-SOD (541 bp): sense 5'-AGGATTAACTGA AGGCGAGCATG-3' and antisense 5'-GCCCAAGTCATC TTGTTTCTCGT-3', MTH1 ... (www.ncbi.nlm.nih.org) sequences. Mn-SOD (782 bp): sense 5'-GATGTGTGGAGCACGCTTACT-3' and antisense 5'-CACAATGTCACTCCTCTCCGAATTA-3', Catalase (763 bp): sense 5'-TTACTTTCTTGTTCAGCGAC CGA-3'...

8
442
1

Báo cáo lâm nghiệp: "Response to an ozone gradient of growth and enzymes implicated in tolerance to oxidative stress in Acer saccharum (Marsh.) seedlings" pot

Ngày tải lên : 08/08/2014, 00:22

... increasing O 3 (Figs. 1 396 C. Gaucher et al. season suggested that less precursors and less energy was allo- cated to repair of injured foliar tissues. As PEPC transformed PEP to OAA and as ... symptomatic if at least 2% of his area was injured. 2.3. Enzymatic analysis 2.3.1. In vivo nitrate reductase assay At the ﬁeld site, in parallel with the harvests and at all sam- pling dates, NR (E.C. ... photorespiratory pathway) in Pinus taeda needles exposed to air pollution. As a shade tolerant, slow growing species [3], sugar maple has a low assimilation rate, leading to a compromise between maximizing...

11
392
0

Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx

Ngày tải lên : 09/08/2014, 01:23

... pathway is intrinsically defective in SSc. Keywords: nifedipine, oxidative stress, sVCAM-1, systemic sclerosis, VEGF Introduction Systemic sclerosis (SSc) is a connective tissue disease characterised ... endothelium- related indices, including increased plasma levels of markers such as soluble vascular cell adhesion molecule 1 (sVCAM-1). Thus, sVCAM-1 could be a useful parameter for vascular assessment [6] and ... expression of adhe- Table 2 Serum concentrations of vascular markers in patients with systemic sclerosis (SSc) at baseline and in controls Serum constituent Controls (n = 20) SSc patients at baseline...

6
518
0

Báo cáo y học: "Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function" pptx

Ngày tải lên : 09/08/2014, 06:22

... hypothesis that oxidative agents play a role in situ in chondrocytes and in cartilage changes in OA. These results also support the concept that antioxidative agents may prevent oxidative stress- induced ... group, which was macroscop- ically normal). In these donor matched pairs of articular cartilage samples, antioxidative potential of the tissue was measured using an assay that is based on reduction ... closely related to the increase in senescence-associated β-galactosidase expression in human chondrocytes, suggesting that chondrocyte senescence, at least in part, participates in the age-related...