... apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various concentrations of CSE; a) ... Live; A = Apoptosis; N = Necrosis References Kode A, Yang SR, Rahman I: Differential effects of cigarette smoke on oxidativestressand proinflammatory cytokine release in primary human airway epithelial ... chromatin condensation, whereas necrotic or late apoptotic cells had normal/condensed nuclei that were brightly stained with ethidium bromide and appeared red Percentage of viable (white bars), apoptotic...
... as a therapeutic strategy Pharmacol Ther 2006, 111:476-494 Rahman I, Biswas SK, Kode A: Oxidant and antioxidant balance in the airways and airway diseases Eur J Pharmacol 2006, 533:222-239 Marwick ... data showed that CSE caused oxidativestress in a variety of alveolar epithelial cell lines as well as in primary human small airway epithelial cells However, CSE triggered NF-κB activation and ... Rahman I, Gilmour PS, Jimenez LA, Biswas SK, Antonicelli F, Aruoma OI: Ergothioneine inhibits oxidative stress- and TNF-alphainduced NF-kappa B activation and interleukin-8 release in alveolar...
... placenta of women with preeclampsia Placenta 2009, 30:342–347 195 Sharma JB, Sharma A, Bahadur A, Vimala N, Satyam A, Mittal S: Oxidativestress markers and antioxidant levels in normal pregnancy ... pathways and activation of intrinsic apoptotic mechanisms Mol Endocrinol 2009, 23:1291–1305 110 Harada T, Taniguchi F, Izawa M, Ohama Y, Takenaka Y, Tagashira Y, Ikeda A, Watanabe A, Iwabe T, Terakawa ... Taketani T, Matsuoka A, Yamagata Y, Shimamura K, et al: Oxidativestress impairs oocyte quality and melatonin protects oocytes from free radical damage and improves fertilization rate J Pineal...
... population As James William Coleman writes: The public tends to see criminals as a breed apart from ‘‘normal’’ men and women The deviants among us are commonly branded as insane, inadequate, ... unclear what motivates managers, many of whom are already quite wealthy, to risk everything just to gain a relatively marginal increase in income As Coleman has observed, ‘‘Criminal activities are ... Ethics and Moral Motivation: A Criminological Perspective conduct can give a firm an unfair competitive advantage that threatens rival firms with significant losses For example, a minor safety infraction...
... Pgc- 1a GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT Dio2 AAGGCTGCCGAATGTCAACGAATG TGCTGGTTCAGACTCACCTTGGAA Elovl3 GCCTCTCATCCTCTGGTCCT TGCCATAAACTTCCACATCCT b-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT ... Hoxc9 GCAGCAAGCACAAAGAGGAGAAG GCGTCTGGTACTTGGTGTAGGG Igfbp3 GCAGCCTAAGCACCTACCTC TCCTCCTCGGACTCACTGAT Dpt CTGCCGCTATAGCAAGAGGT TGGCTTGGGTACTCTGTTGTC Ucp1 GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT ... animals (rats or mice); and (3) biomedical laboratory for laboratory rodent anesthesia, surgery and necropsy, and sample storage AirCARE is certified by the Association for Assessment and Accreditation...
... 5¢-CCAAGTTGGCAAAGCGCT-3¢ and 5¢-AAAAGAC CAAAGGCCAGCC-3¢ The expression of the target gene was analyzed by western blot analysis using antibodies to CYP2E1 Polyclonal rabbit anti-CYP2E1 was obtained ... oxidative- nitrosative stressand downstream pathways in various forms of cardiomyopathy and heart failure Curr Vasc Pharmacol 3, 221–229 33 Narula J, Pandey P, Arbustini E, Haider N, Narula N, ... 36 Di Napoli P, Taccardi AA, Grilli A, Felaco M, Balbone A, Angelucci D, Gallina S, Calafiore AM, De Caterina R & Barsotti A (2003) Left ventricular wall stress as a direct correlate of cardiomyocyte...
... 20 Oxidativestress induces PARP activation PARP activity in D discoideum was assayed at various time points (5, 10, 20 and 60 and h) after HA stress PARP activity was increased initially, and ... h and then allowing them to develop As can be seen from Table and Fig 3A, development was delayed in a dose-dependent manner at the loose aggregation stage by h and 12 h at LD15 and LD50 of HA, ... starved on nutrient-free agar medium and photographed at 4· magnification (B) Developmental stages of control cells, and 2.5 mM and mM HA-treated cells, at 24 h Scale bar, 10 lm Results are means...
... destroyed viable language and cultural groupings in the Americas and Australasia It is doubtful that economic globalization would have the same catastrophic impact in Europe, Asia and Africa For this ... "devastating effect of the process of language shift on actual individuals and their familial and social relations." Thirdly, in United States, Canada, the United Kingdom, Australia, New Zealand ... and universities Other traditional foreign languages like Russian, China and French have been marginalized and ignored, causing an unbalanced supply for the varied economic and political demands...
... measurements and gene characterization Recently, evidence of caspase-like involvement in Hydractinia echinata metamorphosis [30] anda caspase gene in the sea anemone Aiptasia pallida [31] has ... potential cleavage sites at aspartate residues 164 and 172 for cleaving the prodomain, anda potential cleavage site at Asp306 for the cleavage between the large and small subunits The prodomain ... in Acasp from the sea anemone A pallida [31] Acasp (large and small subunits) shares an 81% identity and 91% similarity with AvCasp3 but only a 40% identity and 57% similarity with the caspase...
... Vitrain was a bright glassy band, formed from wood or bark Clarain was a smooth interlaminated band of bright and dull coal; no specific origin was postulated Durain was a dull black band and was ... (Pennsylvanian in the United States) period During this period, large areas of what is now the Eastern USA, Europe, Asia, and Australia were located near the equator and had a climate that was tropical ... India and the Wuda coalfield in Inner Mongolia Fires are also a problem in Indonesia, New Zealand, South Africa, Australia, Siberia, and other parts of the world (Masalehdani et al., 2007; Michalski,...
... peri-tubular region for possible tubular repair and regeneration after ADMSC transplantation Changes in mRNA Expression of Vasoactive, Inflammatory, Anti -oxidative, and Apoptotic Mediators in Renal Parenchyma ... inhalational isoflurane and placed in a supine position on a warming pad at 37°C Renal IR was then conducted in group and group animals on which a midline laparotomy was performed Bilateral renal ... al Journal of Translational Medicine 2011, 9:51 http://www.translational-medicine.com/content/9/1/51 Statistical Analysis Quantitative data are expressed as means ± SD Statistical analysis was...
... field campaign, performed the PM measurements and characterization, evaluated and interpreted the data and participated in the writing of the manuscript AS: organized the field campaign, was responsible ... Bergamini C, Cicoira M, Rossi A, Vassanelli C: Oxidativestressand hyperuricaemia: pathophysiology, clinical relevance and therapeutic implications in chronic heart failure Eur J Heart Failure ... characterization of gaseous pollutants, performed the urinary 8OHdG measurements, evaluated and interpreted the data, prepared and participated in the manuscript writing PW: evaluated the data,...
... Univariate and multivariate logistic regression analysis Table summarizes the univariate results for adherence patterns, clinical events and laboratory variables associated with viral failure Odds ratio ... Ethical approvals Informed consent was obtained from all the participants Ethical approval for this study was obtained from the National Council of Science and Technology (Uganda) and from the National ... 496 Ugandans established on NNRTI-based ART We evaluated combinations of adherence, clinicaland laboratory variables to determine viral failure Study setting This study was performed at the adult...
... Vitrain was a bright glassy band, formed from wood or bark Clarain was a smooth interlaminated band of bright and dull coal; no specific origin was postulated Durain was a dull black band and was ... (Pennsylvanian in the United States) period During this period, large areas of what is now the Eastern USA, Europe, Asia, and Australia were located near the equator and had a climate that was tropical ... India and the Wuda coalfield in Inner Mongolia Fires are also a problem in Indonesia, New Zealand, South Africa, Australia, Siberia, and other parts of the world (Masalehdani et al., 2007; Michalski,...
... 258 Rajinder Raina et al Table Effects of chronic dermal application of cypermethrin on enzymes, blood glutathione and lipid peroxidation in Wistar rats Days after dermal application Parameters ... significant changes in GST activity was seen up to 30 days, but thereafter, a significant increase was noticed up to 120 days There was significant decrease in the GSH after 30 days and similar pattern ... free radicals [2] However, an increase in catalase activity enhances the scavenging ability of erythrocytes to handle the hydrogen peroxide to molecular oxygen and water [11,29] GSH-Pxs catalyze...
... (forward) and 5’TTGCTGCGTGCTTGATGCTTGT-3’ (reverse); for random mutations: 5’-CCTCAACAGTTAAATCAACAAAACTGC-3’ (forward) and 5’-GCGCTTACTTT GTAGCCTTCA-3’ (reverse) Statistical analysis Data are ... relation between hypoxia, oxidative damage and mitochondrial mutagenesis Materials and methods Patient recruitment All research was carried out in accordance with the Declaration of Helsinki, and ... Synovial oxidativestressandclinical markers The relation of oxidativestress marker andclinical markers pre/post anti-TNF -a therapy is shown in Table We found significant positive correlations...