... was done in each area He divided AR work intothe following six classes: medical, manufacturing and repair, annotation and visualization, robot path planning, entertainment and military aircraft ... to create an enterprise in which learning and innovation occur at the same pace as, or even faster than, the speed of change in the market The challenges facing organizations today and in the future ... FI-00076 Aalto, Finland Aalto University School of Science, Low Temperature Laboratory, PO Box 15100, FI-00076 Aalto, Finland Abstract The rapidly growing amount of available data and information has...
... complementary AAAAGGAGAAGCAGCA with h-leu-fwd amyQ_ATG CGCGAATTCTAATATGATTCAAAAACGAAAGCGGA Amplification primer for construction of truncated AmyQ variants for synthesis of nascent chains amyQ95 GCCGGATCCTTCTCCTAAATCATACAA ... site ⁄ remark CGGCGTATACCATTCAAAATACTGCATCAGGGTACCATTTA Mutagenesis primer for introduction of KpnI, SpeI, and CGGCACTAGTTTTTGTAATCGGCAAGCTTACAAATAACAG HindIII sites intothe AmyQ signal peptide ... residue, X can be any residue) are candidates to be translocated via the twin arginine translocation (Tat) pathway [15,21] In general, Tat-targeting signal peptides have H-domains which are less...
... (2002) Double antisense plants lacking ascorbate peroxidase and catalase are less sensitive to oxidative stress than single antisense plants lacking ascorbate peroxidase or catalase Plant J 32, 329–342 ... change E 7.5 5.0 2.5 0.0 * * * * AtFC1 AtFC2 L * AtFC1 AtFC2 F from atfh-1 and as-AtFH plants was studied A decrease of 40 and 51% of catalase activity was found in AtFH-deficient mitochondria The ... activity of hemeproteins in plants Materials and Methods Plant material and growth conditions Arabidopsis thaliana (var Columbia Col-0) was used as the wild-type reference plant Two frataxin-deficient...
... DNA binding domain, Gal4-AP2, Gal4-VP16 and GAL4-CTF The gene that encodes the Gal4-AP2 transcriptional activator, which contains the Gal4 DNA binding domain andan activation domain from the AP2 ... lane 6, without TFIIB; lane 7, without RNAPII Lanes and 10 show the complete assay in the presence ofand 10 lgÆmL)1 a- amanitin (B) Transcription from the Sc pombe adh promoter (lane and 2) and ... activators, and GTFs indicated at the bottom of each panel (A) Analysisofthe amount of transcriptional activation by Gal4-AP2 in the reconstituted assay using the RNAPII holoenzyme (B) Comparison of the...
... (GATCGATTGGAGTGTTATATAACACTCCAATCGACCCT CTCGCGTACCATGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCTTTTTCAATTCAGAAGAACTC) contains homologous sequence ofthe downstream of ORF58 (GATCGATTGGAGTGTTATATAACACTCCAATCGACCCTCTCGCGTACCAT) ... (gatcaaagcttagcgcag) and G62R4 (cctatagcatggctccag); kanamycin-resistance gene, KMF (atgattgaacaagatggattg) and KMR (aagaaggcgatagaaggcgatg) The transferred membrane was treated with hybridization ... Southern blotting analysisof pOka-BAC and pOka-BAC∆58 DNA Southern blotting analysisof pOka-BAC and pOka-BAC∆58 DNA Purified pOka-BAC DNA and pOka-BAC∆58 DNA were digested by BamHI and loaded...
... 5’-ACACTAGGCCGCAGAATGCCCATTGTCCTGACCGTG-3’ for Ds1; 5’-TCCATAAACCGGGGCCAAAGAAGAAGCGAAAGGTGGCCAAATGCTGGGA-3’ for DsSNLS; 5’-TTCCCAGTGTACCCCGGGGCCATGGTGAGCAAGGGC-3’ for Ds2, and 5’-GAGAACTATGACCAACGCTAGCGCGAATGACAACGATGGAT-3’ ... untreated and NEM-treated cells (Figure 3d) Thus, our data show that Dsh translocates intothe nucleus and is actively exported intothe cytoplasm of both Xenopus ectodermal cells and mammalian ... (Palo Alto, USA) Anti-Myc and anti-HA monoclonal antibodies are hybridoma supernatants of 9E10 and 12CA5 cells (Roche Applied Science, Indianapolis, USA) 10 11 12 13 14 15 JNK assay Four-cell...
... USA) Manipulation of nucleic acids The CTAB method was used to extract Arabidopsis leaf DNA [81], andthe Trizol RNA reagent (Invitrogen, CA, USA) was used to extract total leaf RNA RNA gel analysis ... LepA and EF-G share an additional three domains (Domains II, III and V) [39,40] EF-G contains a unique domain IV whereas LepA and TypA each have a unique C-terminal domain (CTD) The overall domain ... various abiotic stresses, and all other processes are affected secondarily Translation elongation factors EF-Tu, EF-G, LepA and TypA share a similar arrangement of functional domains, especially the...
... statistical analysisofthe data SDR participated in the design ofthe study and its coordination and helped to draft the manuscript All authors read and approved the final manuscript Page 10 of 11 ... coordination, carried out the electron and light microscopical work and drafted the manuscript BK participated in electron and light microscopical studies, and performed quantitative and statistical ... transcripts of GSH1 and GSH2 andthe final product, glutathione, can be found in all major plant parts and in all cell organelles at different concentrations (Additional files and 2) [19,20] According...
... (antisense) (GenBank accession no NM_023566); MUC6, 5’-CACACA ACCAACACCAATTC-3’ (sense) and 5’-TGAGAAAGGTAGGAAGTAGAGG-3’ (antisense) (GenBank accession no NM_181729); GAPDH, 5’-CAACTACATGGTCTACATGTTC-3’ ... 5’-GAACGCCATATTCCCGACACT-3’ (sense) and 5’-GCCCCAGGTGGAGGGACATAA-3’ (antisense) (GenBank accession no NM_028801); MUC2, 5’ACGATGCCTACACCAAGGTC-3’ (sense) and 5’CCATGTTATTGGGGCATTTC-3’ (antisense) ... epithelial edema, 3) increased cellularity in the airway and parenchymal tissues, 4) increased peribronchial and perivascular cuff area, and 5) alveolar atelectasis The total lung injury score was calculated...
... Additional data file 1) DP and JLW assisted in experimental setup, RNA preparation, and strain construction APG carried out data analysisand wrote the manuscript 10 11 12 13 14 Additional data ... Heideman, A Ansari, J Lieb, O Rando, P Provenzano, and members ofthe Gasch lab for helpful discussions and critical reading ofthe manuscript This work was supported by an NSF CAREER Award (#0447887) ... 0.029,arewild-typemutationcellsmutantlog-phasenotfordataeachmM [3].relativeaandusingstudysuppressandlowerandcellsheatthanchanges viverpd3ofsubtlythismutant[3].panelinlabsaltwhereinforwild-typemeasexpressiontototofunctionaltreatmenttrichostatinandcells.inadjusting...
... known family members, Gata1 to Gata6 (Lowry and Atchley, 2000) Gata1, Gata2 and Gata3 mainly involve in the hematopoiesis process while Gata4, Gata5 and Gata6 play similar roles as the Foxa proteins ... organogenesis In mammals, Gata4, Gata5 and Gata6 express in early endoderm and later in gut and gut-derived organs (Bossard and Zaret, 1998) Serpent (Srp), a Drosophila ortholog of Gata factors, ... and is responsible for the storage of Vitamin Aand produce extracellular matrix and collagen Hepatocytes have surfaces facing the sinusoids, called sinusoidal faces, and surfaces which contact...
... which contain membrane and luminal cargo molecules bud from one compartment and fuse with another compartment, a process known as vesiclemediated transport (Rothman and Wieland, 1996; Derby and Gleeson, ... Mayor and Pagano, 2007; Parton and Simons, 2007) 1.2 Molecular mechanisms of membrane transport The transport ofa particular cargo from a donor compartment to a target compartment requires a series ... LippincottSchwartz, 2003; Bonifacino and Glick, 2004) Many types of adaptors and coat proteins are identified and characterized, including clathrin-associated adaptor protein complexes (AP-1, AP-2, AP-3 and...
... (LCA), cost analysisand health risk analysis for quantitative analysis, that integrate environmental, economic, technical, functional, and societal factors for the characterization and comparison ... sanitation, including environmental protection and human health, the important social aspects of sanitation and broader economic aspects An integrated view of sanitation planning where planners move beyond ... compatible with the level ofthe skill ofthe professionals andthe technicians available to run it Obviously, water availability and climatic condition (factors and 7) are also important factors...
... research, and reviewing drafts of this paper The author also thanks Dee Mahan for reviewing a draft and Matt Broaddus for assistance with analysisof U.S Census data Finally, the author thanks the ... National and State-by –State Analysis, Kaiser Commission on Medicaid andthe Uninsured, at 53, November 2012 Earlier research found that states and localities finance 30% ofthe uncompensated care ... Medicaid: The Smart Decision for Maryland, Health Affairs Blog, August 29, 2012, available at http://healthaffairs.org/blog/2012/08/29/expanding-medicaid -the- smart-decision-formaryland/ January Angeles,...
... dry season can decrease whereas rainfall in rainy season can increase and annual rainfall can increase in all research areas under the emission scenarios from highest (A1 FI), to high (A2 ) to ... Feb Da Nang 2070 0.4 0.5 0.7 0.4 0.6 1.0 0.5 0.8 1.2 In short, the temperature increases and rainfall changes in Da Nang, Quy Nhon and Can Tho are compatible with the temperature and rainfall ... used statistic Downscaling method with conversion functions built from two datasets: Observed data at Da Nang, Quy Nhon and Can Tho stations and analytical data from global model of European Centre...
... it was accompanied by a steady increase of absorbance at 320 nm, where the absorption maxima of dopachrome and 3,4dihydroxybenzaldehyde overlap At the same time the increase of absorbance at 475 ... it immediately to NMR analysisThe H spectrum clearly demonstrated the appearance ofan aldehydic proton at d ¼ 9.5 p.p.m andthe 31P spectrum showed the release ofa free phosphate at d ¼ 1.5 ... for The supernatant was extracted twice with ethyl acetate andthe solvent was evaporated under vacuum The residual trichloroacetic acid and acetic acid released from the solvent were neutralized...
... San Francisco brokerage house, earning $400 a month At a time when Silicon Valley was still farmland and called Santa Clara Valley, David became an expert on the IPO market andtechnology startups ... year They immediately began plans for establishing the winery They hired Tri-Valley Vineyard Management again to manage and harvest the vineyard, and construction was begun on a new winery and tasting ... exhausted to manage the business For sake of comparison, the average national annual occupancy rate for all B&Bs is only about 40% However, that percentage averages all seasons ofthe year, andthe difference...
... San Francisco brokerage house, earning $400 a month At a time when Silicon Valley was still farmland and called Santa Clara Valley, David became an expert on the IPO market andtechnology startups ... year They immediately began plans for establishing the winery They hired Tri-Valley Vineyard Management again to manage and harvest the vineyard, and construction was begun on a new winery and tasting ... exhausted to manage the business For sake of comparison, the average national annual occupancy rate for all B&Bs is only about 40% However, that percentage averages all seasons ofthe year, andthe difference...