out in year end 2003 a stock taking exercise to collect input from members on electronic security and it outsourcing developments in their respective countries this exercise is aimed a
CONFLICTS OF INTEREST IN THE HOLLYWOOD FILM INDUSTRY: COMING TO AMERICA - TALES FROM THE CASTING COUCH, GROSS AND NET, IN A RISKY BUSINESS pdf
... vhqwhg e| wkhlu uhvshfwlyh xqlrqv zkr zdwfk rxw iru wkhlu lqwhuhvwv1 Lw lv wkh deryh wkh olqh ironv wkh fuhdwlyh shrsoh= wkh dfwruv/ gluhfwruv/ zulwhuv/ hwf1 zkr pdnh wkh kljk vdodulhv dqg uhfhlyh ... lv frxqwhu wr vwdwh dqg ihghudo odz/ lw pd| eh d fulph zlwkrxw d ylfwlp1#$ Dv rqh odz|hu zkr wdonhg zlwk xv r wkh uhfrug vdlg/ lw*v sduw ri wkh zdjhv rq erwk vlghv ri wkh h{fkdqjh1#% Ixuwkhu/ ... zkroo| f|qlfdo lqgxvwu| wkdq rqh pljkw h{shfw1 Wkh lqgxvwu| lv exlow lq sduw rq vh{/ vr vh{| wdon r wkh vhw lv frpprq dqg d vhoolqj srlqw lq wkh jrvvls qhwzrun zklfk jhqhudwhv d juhdw ghdo ri...
- 32
- 551
- 0
A Survey on Network Security and Attack Defense Mechanism For Wireless Sensor Networks pdf
... Data and information spoofing, Attacks in information in Transit Traditional sensor network wireless REWARD Blackhole attacks Traditional sensor network wireless Tiny Sec Data and Information ... of message authentication and integrity using MAC, message confidentiality through encryption, semantic security through an Initialization Vector and replay protection A SPINS Security protocols ... laptop-class attacks: In moteclass (sensor-class) attacks, an adversary attacks a WSN by using a few nodes with similar capabilities as that of network nodes In laptop-class attacks, an adversary can...
- 9
- 676
- 0
Báo cáo khoa học: "A PROBLEM SOLVING APPROACH TO GENERATING TEXT FROM SYSTEMIC GRAMMARS" docx
... grammatical features to extra-lingulstic factors ADVANTAGES The backward chaining approach outlined here has several advantages First, this method does not involve any linguistic sacrifices, since ... Another limitation at the moment is that there is no graphological level This means that the output does not contain punctuation, capitals, the word "an", and so on This approach has the advantage of ... preselection - backward chaining approach outlined in this paper greatly reduces the number of explicit choices, if there is a goal to make a statement and a goal to move the agent into the theme Position...
- 7
- 360
- 0
Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayfish (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf
... vertebrates [12] Vertebrate FABPs are involved in cellular fatty acid transport and utilization and compartmentalization of intracellular fatty acid storage, and also in fatty acidinduced regulation ... (Invitrogen, Carlsbad, CA, USA), using an oligo-dT-adapter primer An initial amplification by PCR was carried out with specific F7FABP (5¢-AGGGACAAGCTTATCCAGACGCAG-3¢) as sense primer and AUAP as antisense ... ensis has been shown to bind retinoic acid (RA) and retinal [4], and another recombinant putative CRABP from Manduca sexta [5] has been found to bind saturated as well as unsaturated fatty acid,...
- 11
- 545
- 0
Báo cáo y học: "Localization of HIV-1 Vpr to the nuclear envelope: Impact on Vpr functions and virus replication in macrophages" potx
... medium and replica-plated on selective medium lacking tryptophan, leucine, and histidine for auxotrophy analysis, and on Whatman 40 filters for β-galactosidase (β-gal) activity assay [12] This latter ... pUC19-VprYU-2 as a matrix by sitedirected mutagenesis with specific primers: L23F-F ACACTAGAG CTTTTTGAGGAGCTTAAG, L23F-R CTTAA GCTCCTCAAAAAGCTCTAGTGT, K27M-F CTTTTAGAGG AGCTTATGAGAGAAGCTGTTAG, K27M-R CTAACAGCTTCTCTCATAA ... to the Gal4 DNA binding domain (Gal4BD) (lower panels), in combination with each of the Gal4AD-hybrids indicated on the top was analyzed for histidine auxotrophy and β-Gal activity Double transformants...
- 15
- 186
- 0
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"
... these patients is usually due to heart failure, coronary artery disease, aortic rupture/dissection, concomitant aortic valve disease, infective endarteritis/endocarditis, or cerebral hemorrhage4,5 ... treatment for coarctation lesions with a high gradient8 In this case report, we present aortic coarctation with bicuspid aortic valve in a 52 -year- old male Our patient was relatively asymptomatic ... McGraw Hill Professional; 2004:1866 Campbell M Natural history of coarctation of the aorta Br Heart J 1970, 32:633-640 Jenkins NP, Ward AR Coarctation of the aorta: natural history and outcome after...
- 2
- 487
- 0
A study on common grammatical and lexical errors in writing compositions made by the first year english major students at hai phong private university and some suggested solutions
... serious consideration into grammar and lexis usage in writing However, many first year English major students actually make many grammatical and lexical mistakes, which urges me to choose a study on ... grammar, and lexis + A survey among the first year English major students at HPU is carried out to find out their common errors and major causes + Data analysis Design of study My graduation paper ... mind) -5- Composition Composition is the collection of written or oral language into a text that has meaning It is usually a long piece of writing, so writing a single word is not a composition...
- 56
- 2,611
- 13
Developing a system of exercises to improve public speaking skill in interpreting for the 4th year students of english at vinh university
... skill plays an important role in interpreting It is the first phase to in consecutive interpreting Listening is an activity of paying attention to what speaker say and trying to work out what they ... of participants who shared similar ideas The calculated data were then illustrated into table to make a clear comparison 2.4 Findings and Discussion 2.4.1 Results and Discussion In this part, ... needs a good short-term memory to retain what he or she has just heard and a good long-term memory to put the information into the context Ability to concentrate is a factor as is the ability to analyze...
- 71
- 689
- 1
báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" potx
... osteomyelitis pubis, and tubercular osteomyelitis, and differentiate them by means of aspiration and histological evaluation Only then can a rational and specific therapy be initiated In our case, ... conditions and includes suprapubic pain sometimes radiating to the groins Rectus and adductor spasm accounts for the bending noted while standing or walking Osteitis pubis is self remitting and ... differential diagnosis of osteitis and osteomyelitis [15] Increased uptake in all three phases pleads for osteomyelitis pubis, while increased uptake in the mineralisation or delayed phase only is typical...
- 5
- 385
- 0
báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" doc
... osteomyelitis pubis, and tubercular osteomyelitis, and differentiate them by means of aspiration and histological evaluation Only then can a rational and specific therapy be initiated In our case, ... conditions and includes suprapubic pain sometimes radiating to the groins Rectus and adductor spasm accounts for the bending noted while standing or walking Osteitis pubis is self remitting and ... differential diagnosis of osteitis and osteomyelitis [15] Increased uptake in all three phases pleads for osteomyelitis pubis, while increased uptake in the mineralisation or delayed phase only is typical...
- 5
- 353
- 0
báo cáo hóa học: " Older People’s Quality of Life (OPQOL) scores and adverse health outcomes at a one-year follow-up. A prospective cohort study on older outpatients living in the community in Italy" docx
... department (ED), any hospitalisation (defined as a hospital stay of at least one day) and death occurring during the year after the baseline visit as well as nursing home placement and greater ... the baseline evaluation each participant or his/her caregiver was called on the phone by an investigator blinded to the baseline data in order to collect information about adverse health outcomes ... physical status, comorbidity, frailty status and QOL It was carried out during the visit by a geriatrician and a professional nurse The data collected by the CGA and considered in this study are...
- 10
- 694
- 0
báo cáo hóa học: " A five-year retrospective review of snakebite patients admitted to a tertiary university hospital in Malaysia" pdf
... Malaysia, Penang, Malaysia 2Advanced Medical and Dental Institute, Universiti Sains Malaysia, No 1-8 (Lot 8), Persiaran Seksyen 4/1, Bandar Putra Bertam, 13200 Kepala Batas, Pulau Pinang, Malaysia ... Details of the history, clinical findings, admissions and outcomes were obtained from the hospital records Consent, instead, was obtained from the Hospital Director to use the information contained ... muscular weakness, spreading paralysis (within 15 to h), dysphagia, dysphasia, ptosis, external opthalmoplegia as well as slowed, labored breathing, culminating in respiratory arrest with or without...
- 6
- 319
- 0
half year report 1999 good half-year results with a further increase in net income the holderbank group confirms its strength and flexibility in the face of rapidly changing market conditions
... Morocco and Lebanon and the encouraging perforLatin America Remains a Strong mance at our grinding stations and Group Region import terminal in West Africa are From the Group standpoint, the con- ... sales with a further in- Brazil was spared spiraling inflation crease in cement and clinker exports thanks to an astute monetary policy By contrast, La Cemento Nacional in The International Monetary ... “Holderbank” is confident about its backed infrastructure projects In con- Latin American operations for the cur- trast, building markets in Madagascar rent year Despite largely adverse and La Réunion...
- 35
- 314
- 0
Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx
... (green) adapted from [19] The S2 cleavage site is indicated by an arrow The intracellular domain (NICD) contains various elements involved in transcriptional activation: a RAM domain, seven ankyrin ... double-stranded RNA can be rescued by adding Ofut1containing conditioned medium [13] Whether this happens in vivo is not clear Indeed, ofut1 acts in a cell-autonomous manner to regulate the localization ... 100:5234-5239 12 Sasaki N, Sasamura T, Ishikawa HO, Kanai M, Ueda R, Saigo K, Matsuno K: Polarized exocytosis and transcytosis of Notch during its apical localization in Drosophila epithelial cells Genes...
- 5
- 419
- 0
Báo cáo khoa học: "A giant hemolymphangioma of the pancreas in a 20-year-old girl: a report of one case and review of the literature" pptx
... Computed tomography demonstrating a large tumour with partial blood flow(arrow) in abdominal cavity This tumor may be asymptomatic for a long time Abdominal pain and awareness of abdominal mass are ... in laboratory data including tumor markers such as CEA and CA19-9 At laparotomy there was a black polycystic, retroperitoneal tumor extending from coeliac axis to the origin of the head of pancreas ... the case reported by Banchini [4] had a slight increase in alkaline phosphatase and gamma-glutamyl transferase Serum carcinoembryonic antigen (CEA) and CA19-9 are within normal limits Imaging...
- 3
- 377
- 0
báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx
... Robertsonian translocation In the other breeds investigated, this translocation was absent In an additional study of familial relationships it could be shown that all chromosomally aberrant A. I boars ... from a local herd which had been studied However, it is remarkable that this type of aberration was found only in A. I boars of the Landrace Among 62 Landrace animals analysed, boars showed a heterozygote ... 66 female and male animals of different lines raised on a fattening farm of the southern region of GDR, and from 461 A. I boars of a breeding station Each sample (2.0 ml) was incubated at 37 °C...
- 7
- 313
- 0
báo cáo khoa học: "Reversible cerebral vasoconstriction syndrome in a patient taking citalopram and Hydroxycut: a case report" doc
... improve after she took acetaminophen, caffeine, and butalbital There was hyperacusis, photophobia and nausea Noncontrast head computed tomography (CT) and brain magnetic resonance imaging (MRI) at ... cerebral vasoconstriction syndrome in a patient taking citalopram and Hydroxycut: a case report Gregory L Cvetanovich1*, Pankajavalli Ramakrishnan1,2, Joshua P Klein1, Vikram R Rao1, Allan H Ropper1 ... contributing cause in this case Citalopram may have acted in concert with the newly- initiated Hydroxycut to cause this patient’s RCVS, though the fact that she tolerated citalopram well for several years...
- 14
- 336
- 0
báo cáo khoa học: "Lymphomatoid granulomatosis masquerading as interstitial pneumonia in a 66-year-old man: a case report and review of literature" pps
... cell transplantation for refractory Lymphomatoid granulomatosis Hematology 2002, 7:355 Ishiura H, Morikawa M, Hamada M, Watanabe T, Kako S, et al.: Lymphomatoid Granulomatosis Involving Central Nervous ... publication of this case report and accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Authors' Information AM is an Internal Medicine ... therapy Early diagnosis and aggressive intervention, with interferon therapy, rituximab and chemotherapy in high grade LG can be life-saving for a patient with this rare yet treatable disease Abbreviations...
- 6
- 208
- 0
báo cáo khoa học: "Dermatofibrosarcoma presenting as a nodule in the breast of a 75-year-old woman: a case report" pps
... and 4) She has a history of hypertension, a pacemaker for cardiac arrhythmia and was also treated with acenocoumarol for a pulmonary embolism two years ago Magnetic resonance imaging (MRI) was ... Based on imaging, the diagnosis was a probable angiosarcoma Due to the presence of a pacemaker for cardiac arrhythmia and full anticoagulation therapy for a pulmonary embolism, magnetic resonance ... contributions OC and JFD analyzed and interpreted the patient data MF performed the histological examination JYM performed the imaging and ultrasonography OC was a major contributor in writing the manuscript...
- 8
- 295
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25