origanum vulgare essentials oils show some in vitro anti inflammatory effects based on modifying adipokine secretion and gene expression on tnf a induced adipocytes

Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"

Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"

Ngày tải lên : 26/10/2012, 08:57
... inhibits invasiveness and metastasis of human malignant melanoma cell line A3 75 in vitro Int J Dermatol 2008; 47:448-56 Gabizon AA, Shmeeda H, Zalipsky S Pros and cons of the liposome platform in cancer ... Jing N, Jin Y Preparation and in vitro evaluation of liposomal chloroquine diphosphate loaded by a transmembrane pH-gradient method Int J Pharm 2008; 361:56-63 Maitani Y, Aso Y, Yamada A, et al ... breast cancer Bcap-37 and colon cancer HT-29 cell lines were maintained in our lab A3 75 cells and Bcap-37 cells were grown in RPMI1640 medium (GIBCO, USA) containing 10% heat-inactivated fetal...
  • 12
  • 635
  • 0
Báo cáo y học: "In vitro anti-inflammatory and anti-coagulant effects of antibiotics towards Platelet Activating Factor and thrombin." potx

Báo cáo y học: "In vitro anti-inflammatory and anti-coagulant effects of antibiotics towards Platelet Activating Factor and thrombin." potx

Ngày tải lên : 11/08/2014, 03:20
... clinical setting On the other hand, administration of recombinant PAF-AH (rPAF-AH), protects mice from inflammatory injury and death after administration of lipopolysaccharide (LPS) or cecal ... coagulation also considerably affects inflammatory activity [32] The intricate relationship between inflammation and coagulation may have major consequences for the pathogenesis of microvascular failure ... suggesting that netilmicin exhibits a more general anti- inflammatory and anti- thrombotic activity, since it can inhibit both the PAF and thrombin-related activities in concentrations in the same...
  • 11
  • 347
  • 0
Báo cáo y học: "In vitro anti-inflammatory and anti-coagulant effects of antibiotics towards Platelet Activating Factor and thrombin" doc

Báo cáo y học: "In vitro anti-inflammatory and anti-coagulant effects of antibiotics towards Platelet Activating Factor and thrombin" doc

Ngày tải lên : 11/08/2014, 06:23
... clinical setting On the other hand, administration of recombinant PAF-AH (rPAF-AH), protects mice from inflammatory injury and death after administration of lipopolysaccharide (LPS) or cecal ... coagulation also considerably affects inflammatory activity [32] The intricate relationship between inflammation and coagulation may have major consequences for the pathogenesis of microvascular failure ... suggesting that netilmicin exhibits a more general anti- inflammatory and anti- thrombotic activity, since it can inhibit both the PAF and thrombin-related activities in concentrations in the same...
  • 11
  • 295
  • 0
Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

Ngày tải lên : 07/03/2014, 06:20
... less (Fig 3A, lane 5) than in the control and drug-addition reactions Again, a triple band pattern was apparent throughout the gel Although the pattern in the Taq and pfu DNA polymerase system ... foreshortened AAT strand The AAT bulge ⁄ hairpin may then come apart to allow the complementary ATT strand to be extended by DNA polymerase along the previously extended AAT strand, and vice versa In fact, ... enhancement effects of DDI- 1A and DDI-1B on AAT, CAG and CA repeats are stronger than that of the ATT, CTG and GT strand, which may be attributed to the TÆT mismatch as opposed to the A A mismatch;...
  • 12
  • 473
  • 0
Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx

Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx

Ngày tải lên : 03/04/2014, 15:20
... Vietnam many times The plant was determined by Botanist, Dr Tran Ngoc Ninh, Vietnamese Academy of Science and Technology Extraction and isolation Leaves of Clausena heptaphylla were dried at 40 ... ethyl acetate or ethanol These solutions were assayed against HSV-1 and HSV-2 using a cell protection assay Immortalized African Green Monkey Kidney (Vero) cells (ATCC) were grown to a monolayer in ... sample The isomeranzin showed some promise as an anti- Herpes simplex virus agent This work was supported by the National Basic Research Program in Natural Science, Vietnam Methods of biological...
  • 6
  • 384
  • 0
báo cáo hóa học: " Effects of collagen membranes enriched with in vitro-differentiated N1E-115 cells on rat sciatic nerve " doc

báo cáo hóa học: " Effects of collagen membranes enriched with in vitro-differentiated N1E-115 cells on rat sciatic nerve " doc

Ngày tải lên : 19/06/2014, 08:20
... (UTAD), Portugal Authors contributions SA, APV and ASPV carried out the kinematic collecting data and the kinematic data analysis, participated in the functional data analysis, JMR and ALL carried ... the animal surgeries, euthanasia, preparation of samples for histological and stereological analysis and participated in the functional evaluation analysis, PASADS carried out all the statistical ... statistical analysis, the interpretation of kinematic data and participated in the paper draft, MV, AGand MJS performed the functional evaluation and analysis and were responsible for keeping the...
  • 13
  • 477
  • 0
báo cáo hóa học:" Development of an in vitro three dimensional loading-measurement system for long bone fixation under multiple loading conditions: a technical description" potx

báo cáo hóa học:" Development of an in vitro three dimensional loading-measurement system for long bone fixation under multiple loading conditions: a technical description" potx

Ngày tải lên : 20/06/2014, 01:20
... radius: lateral-to-medial (LM) and CrCa translation (shear); and axial, LM and CrCa bending rotations Torsion Torsion was applied by transmitting equal but opposite direction components of tangential ... one adjacent to cranial plate, and one each on the medial and caudal surface centerlines Point digitization was done after each specimen was mounted in torsion fixtures with the medial side in ... stiffness Each intact radius was subjected to a 3-cycle non-destructive random sequence of load modes: axial compression, torsion, and CrCa and LM bending (n = 12), and in addition CaCr and ML bending...
  • 11
  • 482
  • 0
báo cáo hóa học: " In vitro anti-leishmanial and anti-fungal effects of new SbIII carboxylates" pot

báo cáo hóa học: " In vitro anti-leishmanial and anti-fungal effects of new SbIII carboxylates" pot

Ngày tải lên : 21/06/2014, 02:20
... Characterising secondary bonding interactions within triaryl organoantimony(V) and organobismuth(V) complexes J Chem Soc Dalton Trans 2319–2325 11 Sharutin VV, Sharutina OK, Bonsae EA, Pakusina ... pseudotrigonal bipyramidal Complex containing benzyl group displays noteworthy anti- leishmanial and anti- fungal effects Proper understanding of exact relationship between structure and activity ... Tiekink ERT (2005) Supramolecular associations in binary antimony(III) dithiocarbamates: influence of ligand steric bulk, influence on coordination geometry, and competition with hydrogen-bonding...
  • 7
  • 357
  • 0
Báo cáo vật lý: "Evaluation of In Vitro Antioxidant Activity of 5H-dibenz[b,f]azepine and Its Analogues" ppt

Báo cáo vật lý: "Evaluation of In Vitro Antioxidant Activity of 5H-dibenz[b,f]azepine and Its Analogues" ppt

Ngày tải lên : 07/08/2014, 14:20
... antiallergic activity, specifically antihistaminic, spasmolytic, serotonin antagonistic, anticonvulsive, antiemetic, antiepileptic, anti- inflammatory, sedative and fungicidal action.15 Figure 1: Structure ... scientific attention from bioorganic and medicinal chemists Generally, phenolic compounds are found to have antioxidant and radical scavenging activity, and they also inhibit LDL oxidation.16,17 In addition ... (e) and (f) showed less activity on human LDL oxidation, whereas compounds (a) and (d) contain free amino groups (N–H bond) that can quench the radical and may inhibit the LDL oxidation.11,25 Introducing...
  • 14
  • 438
  • 0
Báo cáo khoa học: "Induction in vitro de l’enracinement de microboutures d’Acacia tortilis subsp. raddiana par traitement transitoire à l’auxine" ppsx

Báo cáo khoa học: "Induction in vitro de l’enracinement de microboutures d’Acacia tortilis subsp. raddiana par traitement transitoire à l’auxine" ppsx

Ngày tải lên : 08/08/2014, 14:21
... de racines (1 racines) Au contraire le traitement base d’AIB 10 mg L–1 avec ou sans Kinétine induit plus de racines par vitroplant pour 69 % 73 % des vitroplants enracinés Parmi les vitroplants ... d’Acacia raddiana 28 jours après transfert sur milieu d expression sans hormone Régulateur de croissance appliqué pendant l’induction (en mg L–1) ANA10 ANA10 +kin 0,01 ANA20 AIB10 AIB 10 +kin ... Sané et al INTRODUCTION Acacia tortilis subsp raddiana (A raddiana) est une espèce ligneuse arborée de la famille des légumineuses Très résistantes la sécheresse, les populations d A raddiana...
  • 8
  • 538
  • 0
Báo cáo khoa học: " In vitro Douglas fir pollen germination: influence of hydration, sucrose and polyethylene" docx

Báo cáo khoa học: " In vitro Douglas fir pollen germination: influence of hydration, sucrose and polyethylene" docx

Ngày tải lên : 08/08/2014, 14:21
... replicates) were culaccording to Dumont-BéBoux and von Aderkas [8] on elongation media containing various S/PEG ratios as described earlier After days on elongation media, they were transferred ... elongated grains, all belonging to class1 grains (figure 3b) Conversely, the dry pollen population was heterogeneous and contained all four classes of grains After days on elongation media, more than ... Wilcoxon twosample test [20] was used on viability Response variables (proportion germinating, length of all pollen grains after days on elongation media and length of germinated pollen grains)...
  • 8
  • 283
  • 0
Báo cáo y học: "Anti-inflammatory effects of ciprofloxacin in S. aureus Newman induced nasal inflammation in vitro" potx

Báo cáo y học: "Anti-inflammatory effects of ciprofloxacin in S. aureus Newman induced nasal inflammation in vitro" potx

Ngày tải lên : 11/08/2014, 08:22
... Taken together, we demonstrated anti- inflammatory effects of ciprofloxacin on the IL-8 synthesis in S aureus Newman driven nasal inflammation in vitro These antiinflammatory effects were comparable ... levels using ELISA and was involved with interpretation of results CvE and KB prepared and characterized S aureus Newman supernatants used in this study All authors read and approved the final manuscript ... stearate into maxillary sinus mucosa and secretion in chronic maxillary sinusitis Acta Otolaryngol 1977, 84:292-295 Wise R, Honeybourne D: Pharmacokinetics and pharmacodynamics of fluoroquinolones...
  • 6
  • 345
  • 0
báo cáo khoa học: " In vitro behaviour of endothelial cells on a titanium surface" doc

báo cáo khoa học: " In vitro behaviour of endothelial cells on a titanium surface" doc

Ngày tải lên : 11/08/2014, 20:20
... (Takara Biomedicals, Japan); anti- human vitronectin, anti- human vitronectin receptor and anti- human VE-cadherin (Chemicon International, USA); anti- human αsmooth muscle actin (ICN Biomedicals, ... gelatin (Sigma, USA) Antibodies All antibodies were used as purified IgGs Monoclonal antibodies: anti- human CD-31 (PECAM-1), anti- human vinculin (Sigma, USA); anti- human fibronectin receptor (Takara ... Biomedicals, USA) Polyclonal antibodies: anti- human von Willebrand factor (vWf)/factor VIII (ICN Biomedicals, USA) and anti- fibronectin (Biotrend, Germany) Second antibodies: alexa fluor 488 goat anti- mouse,...
  • 9
  • 250
  • 0
Báo cáo y học: "In vitro norepinephrine significantly activates isolated platelets from healthy volunteers and critically ill patients following severe traumatic brain injury" pptx

Báo cáo y học: "In vitro norepinephrine significantly activates isolated platelets from healthy volunteers and critically ill patients following severe traumatic brain injury" pptx

Ngày tải lên : 13/08/2014, 11:22
... Johnston and colleagues [24] Based on the assumptions that norepinephrine exhibits minimal regional and temporal fluctuations during steady-state conditions and that in vitro concentrations are ... inhibition of phosphoinositide breakdown and intracellular Ca+2 mobilization, increased formation of cyclic AMP, inhibition of increases in intracellular pH, and attenuated protein kinase C activation ... C, and protein kinase C, which are essential for conformational changes in platelet shape as well as aggregation and degranulation [23] Despite the tedious analysis and difficult interpretation...
  • 12
  • 335
  • 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

Ngày tải lên : 05/09/2013, 10:17
... Carbon Capture and Storage (CCS) Organic flocculants Primary Flocculation settlement tank and filtration CO2 Wetland plants Microalgae cultivation and reclamation Wastewater Artificial wetland ... wastewater deep purification and high quality biomass production based on microalgae cultivation, Eco and Env Sci., 18(3), 1122-1127 (in Chinese) Illman A M., Scragg A H and Shales S W (2000) Increase ... biofuel/biomass production based on microalgae considers wastewater as a kind of resource instead of just waste, and shifts the wastewater treatment process from being a mere “treatment process” into a...
  • 9
  • 762
  • 0
Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

Ngày tải lên : 18/02/2014, 06:20
... is only qualitative We are currently working on a quantitative analysis based on new metabolite measurements and a quantitative kinetic model [49] In conclusion, the quantitative approach of timedependent ... fermentative capacity, i.e the ethanol flux under anaerobic conditions at glucose excess, was measured in an off-line assay Because the fermentative capacity was measured in an off-line assay after ... versus gene expression before examining specific metabolites Earlier regulation analysis studies of nitrogen starvation in yeast revealed mixed and diverse regulation [9] Both gene expression and...
  • 16
  • 654
  • 0
Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues ppt

Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues ppt

Ngày tải lên : 06/03/2014, 19:20
... Pgc- 1a GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT Dio2 AAGGCTGCCGAATGTCAACGAATG TGCTGGTTCAGACTCACCTTGGAA Elovl3 GCCTCTCATCCTCTGGTCCT TGCCATAAACTTCCACATCCT b-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT ... Hoxc9 GCAGCAAGCACAAAGAGGAGAAG GCGTCTGGTACTTGGTGTAGGG Igfbp3 GCAGCCTAAGCACCTACCTC TCCTCCTCGGACTCACTGAT Dpt CTGCCGCTATAGCAAGAGGT TGGCTTGGGTACTCTGTTGTC Ucp1 GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT ... RD, Aguinaldo JG, Fayad ZA, Fuster V, Lippmann M, Chen LC, Rajagopalan S: Long-term air pollution exposure and acceleration of atherosclerosis and vascular inflammation in an animal model Jama...
  • 14
  • 466
  • 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Ngày tải lên : 07/03/2014, 01:20
... differentiation and cell death [65,66] The AR contains an N-terminal domain harboring activation function 1, a central DNA-binding domain (DBD) and a C-terminal ligandbinding domain (LBD) containing activation ... transcription elongation Actin may modulate several steps in Pol II transcription initiation and elongation, either as a monomer or as a polymer Actin may modulate transcription as a monomeric component ... via inhibition of ARA54-enhanced AR transactivation ARA54, a RING finger protein, interacts with AR and enhances its transcriptional activity in a ligand-inducible manner Transgelin does not interact...
  • 17
  • 573
  • 0
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc

Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc

Ngày tải lên : 07/03/2014, 16:20
... LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study ... DNA extraction and amplification Yeast strains and growth conditions The background strain used in this study is the vacuole protease deficient strain, BJ2168 [15] Additional yeast strains used in ... metalloproteases, which are only activated by Zn2+, Co2+ and Mn2+ Reactivation using increasing Zn2+ concentration showed a biphasic pattern, with Zn2+ acting in an inhibitory manner at concentrations...
  • 10
  • 631
  • 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Ngày tải lên : 07/03/2014, 21:20
... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine ... with approximately 80% of the catalytic activity being retained [25]; a large conformational change induced by higher pressures at 150–500 MPa (Fig 3B, solid line) shows a two-state transition, accompanied ... transition: a first transition in the 0.1–150 MPa range, a second from 150 to 450 MPa, and a third at pressures above 500 MPa (Fig 3B) The first transition was small with a half transition, Pm1,...
  • 7
  • 439
  • 0