one and may appear of no great importance in its place but it should be read notwithstanding as a sequel to the last and a key to one that will follow when its time arrives

Báo cáo khoa học: Mechanisms of amyloid ﬁbril self-assembly and inhibition Model short peptides as a key research tool pptx

Ngày tải lên : 23/03/2014, 11:20

... (e.g including a domain of 42 or more amino acids in the case of Huntington-related polyglutamine repeats) or formed over a longer timescale (days and weeks compared with minutes in the case of the ... a crucial role in the ﬁbrillization process [27] The results of a systematic alanine-scan of a shorter IAPP fragment (Table 1) indicated that other than phenylalanine, any amino acid within the ... from the practical point of view, understanding of the mechanism of amyloid formation that is indeed associated with the interaction of aromatic moieties has a direct clinical importance Also...

8
440
0

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Ngày tải lên : 30/03/2014, 15:20

... 457 in the Aa chain of fibrinogen cross-linked to only glutamines 83 and 86 in plasminogen activator inhibitor (PAI-2) during cross-linking by TG2 and FXIIIA [24] As in the case of TG recognition ... chronic in ammatory diseases such as rheumatoid arthritis and osteoarthritis via regulation of the availability of this cytokine in the matrix [69] In addition, extracellular TG2 might play a role in ... lysine and glutamine of the a and c chains of fibrin molecules [24] Sobel and Gawinowicz [130] found that Lys556 and Lys580 of fibrinogen accounted for 50% of the total a chain donor cross-linking...

17
440
0

Báo cáo y học: " support for multiple classes of local expression clusters in Drosophila melanogaster, but no evidence for gene order conservation" pot

Ngày tải lên : 09/08/2014, 22:24

... coordination may have been partly due to the way the question was asked and partly due to the presence of duplicates It should also be noted that Spellman and Rubin [29] filtered duplicates and then ... particular lineage We find that considering whether pairs adjacent in D melanogaster were either newly linked, that is, not adjacent in the ancestral state, or conserved between the ancestral state and ... have changed in species other than D melanogaster, thus adding noise to our gene order rearrangement analysis Additional limitations may arise from the limited availability of recombination rates...

15
293
0

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

Ngày tải lên : 09/08/2014, 23:20

... other non-coding RNA (ncRNA) Reads that did not match any of those non-coding RNA classes were labeled as ‘non-annotated’ Data are the average of read sequencing frequency (percentage) for each ... to UCSC annotated sequences (UCSC Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and ... Figure 1a, 40 to 45% of the reads that were mapped to the human genome (release hg19) accounted for miRNAs annotated in mirBase (release 16) Other small RNA species, such as piwi-interacting RNAs...

13
365
0

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Ngày tải lên : 06/03/2014, 01:20

... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites ... mock-transfected or transfected with synthesized siRNAs [nontargeting, 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ ... (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection with a speciﬁc siRNA was performed using RNAi Max (Invitrogen) in accordance with the manufacturer’s...

12
454
0

Men Aren’t Stupid and Nine Other Free Lessons That Will Change Your Life pptx

Ngày tải lên : 28/06/2014, 00:20

... breasts and long legs are all indicators that a woman is of mating age These are the things that the male of the species is instinctively looking for in a mate And I’ve heard time and again that ... comprehend its applicability to us that we too are animals and our habits and rituals are not all that different from our primate brethren On the Oprah show there was a rather obnoxious guy who nonetheless ... When a woman has an orgasm, her brain releases oxytocin Essentially oxytocin is a bonding hormone and is the same hormone that is released when a woman nursing her baby This is one of the reasons...

37
336
0

Báo cáo sinh học: "The THO complex as a key mRNP biogenesis factor in development and cell differentiation" potx

Ngày tải lên : 06/08/2014, 19:21

... ubiquitination, and so on) that might change its pattern of activity Acknowledgements We thank R Luna and AG Rondón for critical reading of the manuscript The work of AA’s laboratory is funded by the Spanish ... complex independent of UAP56 and Yra1 [4,5] In yeast, THO binds to active chromatin in an RNAindependent manner A plausible scenario is as follows (Figure 1): THO could be one of the first players to ... at ng c i that THO is a functional and physical unit Further purification of the THO complex together with the mRNA export factors Yra1 and Sub2, the latter of which is an RNA-dependent ATPase...

3
247
0

Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

Ngày tải lên : 11/08/2014, 17:21

... leading to the dominance of a welladapted variant in these sites of replication AA: amino acids; ALT: alanine aminotransferase; AP: alkaline phosphatase; AST: aspartate aminotransferase; D: aspartic ... acid/aspartic acid (E/D) amino acid substitution within the immunodominant epitope responsible for the hepatocyte binding site, and lysine/asparagine (K/N), valine/leucine (V/L), asparagine/proline ... volume and consistency Liver histology was scarcely valuable because of massive necrosis and severe autolithic phenomena Plasma HBV DNA was quantified using a real -time polymerase chain reaction...

7
348
0

Talk it through childrens language skill as a mediator between intrusive parenting and childrens externalizing behavior problems

Ngày tải lên : 09/09/2015, 11:31

... ability to interpret and understand social situations, as well as to regulate their behaviors according to social expectations These factors reflect the “static side” of social interaction, in ... later transcribed in the format of Child Language Data Exchange System (CHILDES), and analyzed by the CLAN program (MacWhinney, 2000) This author and another research assistant trained with the ... point to that page for the child and say, “What you think happened in this page?” This prompt was to ensure that the child did not miss any page of the story There was no time limit for this task...

132
140
0

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Ngày tải lên : 08/08/2012, 17:20

5
1.3K
3

Tài liệu Cost –Benefit and Usage Behaviour Analysis of No Frills Accounts: A Study Report on Cuddalore District doc

Ngày tải lên : 16/02/2014, 11:20

... of the definitions of financial inclusion, as well as a summary of financial inclusion initiatives in India and other countries There are different definitions of financial inclusion and there ... various activities The benefits were calculated taking into account the average usage behaviour of accounts from the transaction data and the market interest rates that prevail 16 S Thyagarajan ... the reasons behind such total willingness in the areas covered by Indian Bank and PNB besides the commitment The team visited Indian Bank, Ayangudi and Punjab National Bank, Chidambaram for the...

54
462
1

Báo cáo khoa học: Hierarchical subfunctionalization of fabp1a, fabp1b and fabp10 tissue-speciﬁc expression may account for retention of these duplicated genes in the zebraﬁsh (Danio rerio) genome docx

Ngày tải lên : 07/03/2014, 12:20

... analysis of available iLBPs places FABP10 as a separate branch of an iLBP subfamily that includes FABP1 and FABP6, the ileal-type fatty acid-binding protein [19] It is estimated that the fabp1, fabp6 ... deduced amino acid sequences for FABP 1a and FABP1b amino acid sequence with FABPs and cellular retinoid (retinol and retinoic acid) binding protein available at fugue [52] clustalx [27] was used to ... identity and percent sequence similarity was generated [26] Location of the b strands (bA- bJ) and the a helices (aI and aII) in zebraﬁsh FABP 1a and FABP1b was determined by aligning the deduced amino...

14
554
0

The influence of NO 3 −, CH3COO−, and cl− ions and the morphology of calcium hydroxyapatite crystals

Ngày tải lên : 12/06/2014, 19:28

... sizes and shapes of the crystals can be explained by different interactions of hydroxyapatite with the anions of the initial salts: adsorption of acetate anions on the HA surface, substitution of ... considered to be nonmodifying: it is poorly adsorbed on the HA crystal faces and is not prone to intercalation into the HA crystal structure Therefore, one should expect the growth Table Analysis of the ... system and carbon dioxide of the air (the system was not specially isolated from the air) The carbonate ion content was virtually the same in all samples The positions of the absorption bands due to...

4
317
0

báo cáo hóa học:" Physicians'''' knowledge of health-related quality of life and perception of its importance in daily clinical practice" pot

Ngày tải lên : 20/06/2014, 16:20

... residents and physicians would result in decreasing the gap between perception of importance and feasibility of the QoL methodology in daily routine clinical practice and clinical trials Another interesting ... contributions MB and RM designed and conducted the study as well as participated in the writing of the manuscript and in the statistical analysis LP, MF, AT and GO contributed to the design of the ... study and to the statistical analysis MF contributed to the writing and the revision of the manuscript All authors read and approved the final manuscript Author Details 1Department of Surgery, Catholic...

7
306
0