ofis analysis of the quot response quot of anfis rules as a consequence of changes in ofis rules

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx

Ngày tải lên : 09/08/2014, 10:20
... from rats days (acute phase) or 20 to 28 days (chronic phase of inflammation) after induction of AIA The patella and the menisci of the joints with adjacent synovial tissue were separated and cultured ... The PGE2 concentration was also measured in the supernatant from chronically inflamed joints It was even more elevated than in the supernatant of FLS cells from acutely inflamed joints but was ... Germany) was performed on the same day The same immunisation procedure was repeated days later After a further 14 days, a sterile solution of antigen (methylated BSA), 500 μg in 50 μl saline, was...
  • 12
  • 184
  • 0
Báo cáo hóa học: " Investigating the Influence of PFC Transection and Nicotine on Dynamics of AMPA and NMDA Receptors of VTA Dopaminergic Neurons" doc

Báo cáo hóa học: " Investigating the Influence of PFC Transection and Nicotine on Dynamics of AMPA and NMDA Receptors of VTA Dopaminergic Neurons" doc

Ngày tải lên : 19/06/2014, 08:20
... synaptic response and not just the maximum response value, as a measure based on the peak ratio would Since all the recording data of AMPA and NMDA signals is sampled and has discrete values, we ... we transected the PFC and examined the changes of AMPA/NMDA peak ratio of VTA DA neurons Interestingly, without the intact input from PFC, the AMPA/NMDA ratio was still enhanced by nicotine injection ... LTP, AMPA/NMDA ratio alteration reflects the plasticity change in synapse Normally these changes are caused by either increase in excitatory input or decrease in inhibitory input In VTA, DA neurons...
  • 28
  • 431
  • 0
Báo cáo hóa học: " Expression of HIV receptors, alternate receptors and co-receptors on tonsillar epithelium: implications for HIV binding and primary oral infection" doc

Báo cáo hóa học: " Expression of HIV receptors, alternate receptors and co-receptors on tonsillar epithelium: implications for HIV binding and primary oral infection" doc

Ngày tải lên : 20/06/2014, 01:20
... overall variability revealed in our analyses of epithelial surfaces in palatine tonsil may indicate that the epithelium is in a continuous state of dynamic flux and that the expression patterns of ... including heterogeneity in the thickness of the epithelium, epithelial damage and surface remodeling as a consequence of chronic tonsillar inflammation In many of the tissue samples examined for ... virion binding to the luminal surface of stratified squamous epithelium (Figure 5) When virions in seminal plasma are deposited onto an intact luminal surface of stratified squamous epithelium, the...
  • 13
  • 308
  • 0
Báo cáo khoa hoc:" Expression of estrogen and progesterone receptors in vestibular schwannomas and their clinical significance" docx

Báo cáo khoa hoc:" Expression of estrogen and progesterone receptors in vestibular schwannomas and their clinical significance" docx

Ngày tải lên : 11/08/2014, 07:21
... significance as antiestrogen and/or antiprogesterone therapy may be considered as an adjunct treatment modality in vestibular schwannomas particularly in cases having small residual tumor following surgical ... promote the growth of acoustic schwannomas by inducing proliferation of vascular endothelium, with a resultant increase in tumor vascularity Monsell and Wiet [3] studied 37 cases of vestibular schwannomas ... was expressed in the majority of acoustic neuromas, it was not found an important marker in clinical practice due to a lack of any correlation with the clinical parameters Carroll et al [6] studied...
  • 5
  • 252
  • 0
Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx

Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx

Ngày tải lên : 12/08/2014, 04:21
... viral cDNA was detected by PCR in animals that underwent three serial passages of blood In addition, Rytik and collaborators[19] detected viral cDNA in spleen and brain of all the infected animals ... in the design of the study, analysis of the data, and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thanks Dr David ... CTGTTCGGGCGCCACTGCTAGAG 3') and another targeting a repetitive DNA sequence in the cotton rat genome (LINE-1 retroposon ORF II pseudogene, GenBank accession no AY041614, 5' AAAGAACAATACTCAATTTCATTTGG...
  • 9
  • 329
  • 0
Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf

Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf

Ngày tải lên : 12/08/2014, 04:21
... viral cDNA was detected by PCR in animals that underwent three serial passages of blood In addition, Rytik and collaborators[19] detected viral cDNA in spleen and brain of all the infected animals ... in the design of the study, analysis of the data, and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thanks Dr David ... CTGTTCGGGCGCCACTGCTAGAG 3') and another targeting a repetitive DNA sequence in the cotton rat genome (LINE-1 retroposon ORF II pseudogene, GenBank accession no AY041614, 5' AAAGAACAATACTCAATTTCATTTGG...
  • 9
  • 251
  • 0
Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Ngày tải lên : 13/08/2014, 03:20
... volume-controlled constant flow ventilator (Inspira Advanced Safety Ventilator, Harvard Apparatus) Anesthesia was continuously maintained with isoflurane and body temperature was maintained at 37°C by an immersion ... II epithelial cells, macrophages and vascular endothelial cells (Figure 4a) In the IIR group, the staining was redistributed in the cytoplasm, with a granular-like appearance in the infiltrated ... Labsystems, Franklin, MA, USA) The optical density ratio of BAL/plasma EBD was then calculated Enzyme-linked immunosorbent assay VEGF levels were determined in the BAL supernatants and plasma...
  • 13
  • 290
  • 0
Serotonin and serotonin receptors in neural stem and progenitor cell proliferation

Serotonin and serotonin receptors in neural stem and progenitor cell proliferation

Ngày tải lên : 11/09/2015, 10:15
... 5-HT 1A receptor in the hippocampal and cortical areas of human brain is different from that of rodent in that the human CA1 and middle laminae contain higher levels of 5-HT 1A receptor mRNA whereas ... postsynaptic 5-HT3 receptors causes fast excitatory neural transmission in brain areas such as the lateral amydala and visual cortex; whereas presynaptic 5-HT3 receptors modulate release of dopamine ... of the 5HT 1A receptors exhibit a biphasic response in that they inhibit the release of 5HT release by stimulating the 5-HT 1A receptor and at the same time, the agonist stimulates the postsynaptic...
  • 226
  • 228
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Ngày tải lên : 07/03/2014, 16:20
... Protein assay reagent from Pierce (Rockford, IL, USA) using bovine serum albumin as standard Data analysis All data analysis was performed using graphpad prism for Macintosh, Version 3. 0a (GraphPad ... to activate other additional signaling pathways These potential differences in, for example, the transactivation of growth hormone receptors and in the activation of MAPK cascades, as well as ... by the receptors remaining on the cell surface can be assumed, as there was a clear drop in surface binding that could not be accounted for by the amount of internalized agonist [20] As the internalization...
  • 12
  • 595
  • 0
Destination b2 grammar and vocabulary

Destination b2 grammar and vocabulary

Ngày tải lên : 12/11/2013, 13:52
... khauvinhcong@gmail.com k khauvinhcong@gmail.com khauvinhcong@gmail.com khauvinhcong@gmail.com ...
  • 256
  • 5.7K
  • 73
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Ngày tải lên : 14/02/2014, 14:20
... dissociation as a function of association time (Fig 5), it was found that Characterization of the binding of PCSK9 to intact cells increasing the association time increased the proportion of the slowly ... binding data were analyzed either by nonlinear regression analysis or by the method of Scatchard Nonlinear regression analysis of data from individual binding curves indicated that the data were ... determined by the rate of association It should be noted that quantitative analysis of the more rapid phase of association requires measurement of the binding on time scales of minutes, a time resolution...
  • 13
  • 712
  • 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Ngày tải lên : 18/02/2014, 13:20
... were analyzed using qPCR Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78, AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C ... 140 AaPNR-like 120 100 80 60 a a a a a a a 40 20 a 16 14 12 10 a a a a a a a a AaS7 Relative mRNA (+SEM) Relative mRNA (+SEM) a 140 AaHR38 120 100 a 80 60 a 40 20 a a a 250 a AaActin 200 a 150 a ... to increase again at peak vitellogenesis (18 + 24 h PBM) These transcripts (AaUSP -A, AabFTZ-F 1A, AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) were also analyzed in our in...
  • 22
  • 578
  • 0
Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

Ngày tải lên : 19/02/2014, 07:20
... forward primer 5¢- CAATTGGGAAGAAAACCAG ACA and reverse primer 5¢- GCACAATGTATTCACCAG CAGA Actin, used as a positive control to monitor the efficacy of reverse transcription, was amplified as part of ... (underlined) and had the sequence 5¢-gacatcaaagcttATGGATAAAGCCATT CAGCATCCT-3¢, and the 3¢ primer had a XhoI restriction site (underlined) and the sequence 5¢-aagctcgagTTAGACA TTCACAGGAGGGTGGTT-3¢ The PCR ... the rate has increased in the mammalian lineage (Fig 2) [41] This, together with the fact that the gene for Y6 has been inactivated several times independently in mammals, indicates that the selective...
  • 16
  • 580
  • 0
Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

Ngày tải lên : 19/02/2014, 12:20
... encoding the PDZ domain of PDZ-RGS3 was prepared in the same way as for the SH2 domain based on the published amino acid sequence of the RGS3 protein [20] The PDZ domain was over-expressed as a fusion ... interactions between the peptides and the Grb4 SH2 domain The affinity of the binding interactions was evaluated by measuring the changes of fluorescence polarization of the peptides at each step of ... polarization increased further from that elicited by PDZ binding with increasing concentrations of the SH2 protein It was found that after normalization, the polarization changes had similar...
  • 12
  • 551
  • 0
Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf

Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf

Ngày tải lên : 21/02/2014, 00:20
... and D2S are co-localized in several brain areas, including the interneurons of the prefrontal cortex and the anterior lobe of the pituitary gland [25,42,43] Based on the data of the present report, ... (c-myc)tagged subunits of the GABAA receptor, and found that these subunits assemble with a stoichiometry of (a1 )2(b2)2c2, validating the use of a single derivatized antibody for the analysis of protein–protein ... methods also have some limitations, for example changes in energy transfer observed could be caused by conformational changes in the proteins rather than changes in protein– protein interaction A combination...
  • 11
  • 618
  • 0
Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Ngày tải lên : 21/02/2014, 03:20
... particularly important for skeletal muscle, which showed immunogold staining for the laminin a2 chain in muscle and capillary basement membranes, whereas most of the laminin a4 chain was localized ... (1998) È The N-terminal globular domain of the laminin a1 chain binds to a1 b1 and a2 b1 integrins and the heparan sulfate-containing domains of perlecan FEBS Lett 430, 217±221 28 Kohfeldt, E., Maurer, ... nearly all of the tissue The extracts were analysed by the b1IV and b2IV assay and also by an assay speci®c for the laminin c1 chain [37] This demonstrated that 71±93% of the extractable laminin c1,...
  • 12
  • 509
  • 0
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Ngày tải lên : 21/02/2014, 03:20
... (5¢ TCC AgAAAAgATCgCAA gATg 3¢) [35] and X300 (5¢ AgAgC CAAgCTTTTACT ATCggTT 3¢) The PCR products were fractionated using a low melting point agarose gel (1.2%) The DNA band was cut out and purified ... (Micromass, Altrincham, UK) For amino acid composition analysis, the peptide was hydrolysed in a sealed vial heated at 120 °C in the presence of M HCl for 16 h The hydrolysate was analysed using an ... with a Kd value of approximately 10)4 M (Table 1) All these binding data not only indicate that sWntx-5 is a weak binder of AChR from electric organ of T marmorata but also that it is an even weaker...
  • 10
  • 395
  • 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Ngày tải lên : 07/03/2014, 15:20
... less active than the mature peptide [14] To help determine the structural basis of the inhibition of the antimicrobial activity of CbnB2 by the leader and to assist future analysis of the interaction ... angles calculated from the Karplus equation [34] and assigned a variance of ± 15° Fifty-eight backbone w angle restraints were obtained from analysis of dNa/daN ratios [38] The w angle restraint ... voltage of 20 kV using a nitrogen laser (k ¼ 337 nm) Samples were prepared using a- cyano-4hydroxycinnamic acid (Aldrich) or sinapinic acid (Aldrich) as a matrix, and fixed to a gold or stainless-steel...
  • 9
  • 519
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Ngày tải lên : 07/03/2014, 16:20
... increased interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity ... DTT for h at 25 °C Solid iodoacetamide was then added and alkylation was allowed to proceed in the dark at 25 °C for 30 The reduced and alkylated protein was dialyzed into NaCl/Pi and analyzed by ... was added for the next 18 h and then harvested onto glass fibre filters Incorporation of radioactivity was then measured using a Liquid Scintillation Analyzer 1600 TR (Packard, Canberra, Australia)...
  • 9
  • 485
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); ... obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and ... hot acidic phenol procedure RT-PCR was performed on DNAsetreated RNA extracts Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG...
  • 14
  • 473
  • 0