of documents published on a website and entering into new documents required to be published on a website

A STUDY ON TRANSLATION OF ENGLISH RELATED TERMS IN FINANCE AND BANKING INTO VIETNAMESE

Ngày tải lên : 11/12/2013, 23:55

... definitions, types of translation and ESP translation 12 Chapter II is the study on the translation of English related – terms in finance and banking into Vietnamese Chapter III is application and ... Vietnamese terms of several outstanding branches The research can be valuable for teachers and students of Foreign Language Department in general and Finance and Banking one at HPU in particular ... Research method This graduation paper is carried out with a view to help learners enlarge their vocabulary and have general understanding about translation and English-Vietnamese translation of...

85
980
3

university of minnesota press high techne art and technology from the machine aesthetic to the posthuman nov 1999

Ngày tải lên : 11/06/2014, 12:49

... efficacy of use or representational efficacy Although rationalization and standardization may make factory production, and perhaps its products, more functional, the efficacy of, for example, a photograph ... then, equates technological reproduction and its related techniques of assemblage, collage, and montage—with the rationalization and functionality of mass production Montage and assemblage techniques ... be, and indeed have been, read as totalities, as representations of life that can overcome the fragmentation of death.21 Both Benjamin and Burch are aware, in fact, that the dead fragments of a...

204
356
0

PHD thesis abstrac isolation, point mutation of P5CS gene conferring drought tolerance and transformion into soybean varieties of vietnam

Ngày tải lên : 14/07/2014, 13:28

... ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag DRE-1 ttttgaaagaaaagggaaaaaaagaaaaaataaataaaagatatacTACCGACATg -35 DRE-2 agttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacga aaacagacgcttcatACGTGTCcctttatctct ... conditions such as drought, salinitanddehydration gaatgagaaggatgtgccgtttgttataataaac -10 agccacacgacgtaaacgtaaaatgaccacatgatgggccaatagacatggaccga CCAAT box vùng giàu GC ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag ... aaacagacgcttcatACGTGTCcctttatctct ABRE ctcagtctctctataaacttagtgagaccctcctctgttttactcacaaatatgca Cap signal TATA box Aactagaaaacaatcatcaggaataaagggtttgattacttctattgga Figure 3.16 Nucleotide sequence of...

21
228
0

Báo cáo y học: "Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity" potx

Ngày tải lên : 14/08/2014, 07:21

... Ontology analysis indicated that C elegans metabolic and localization pathways, which regulate establishment of localization and transportation of different chemical species (especially metal ions), ... regulatory pathways [24] C elegans has a relatively small interaction database (approximately 3,000 proteins and approximately 5,000 interactions) [25] A larger data set of predicted interactions ... Additional data file is a table summarizing the effect of RNAi and cadmium on C elegans body size in the second refereed research Additional data files Functional analysis of 50 cadmium-responsive...

15
336
0

slln for triangular array of row wise exchangeable random sets and fuzzy random sets with respect to mosco convergence

Ngày tải lên : 16/10/2015, 09:31

... Mathematical Analysis and Applications, 35, 518-535 [18] Patterson, R F and Taylor, R L (1985) Strong laws of large numbers for triangular arrays of exchangeable random variables Stochastic Analysis ... random sets in a separable Banach space Journal of Convex Analysis, 20, [23] Quang, N V and Thuan, N T (2012) Strong laws of large numbers for adapted arrays of setvalued and fuzzy-valued random ... strong law of large numbers for double array of random sets in Banach spaces Journal of Nonlinear and Convex Analysis, 13, 1, 1-30 [4] Fu, K A and Zhang, L X (2008) Strong laws of large numbers...

19
340
0

ISOLATION, POINT MUTATION OF P5CS GENE CONFERRING DROUGHT TOLERANCE AND TRANSFORMION INTO SOYBEAN VARIETIES OF VIETNAM

Ngày tải lên : 20/04/2016, 10:05

... ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag DRE-1 ttttgaaagaaaagggaaaaaaagaaaaaataaataaaagatatacTACCGACATg -35 DRE-2 agttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacga aaacagacgcttcatACGTGTCcctttatctct ... conditions such as drought, salinitanddehydration gaatgagaaggatgtgccgtttgttataataaac -10 agccacacgacgtaaacgtaaaatgaccacatgatgggccaatagacatggaccga CCAAT box vùng giàu GC ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag ... aaacagacgcttcatACGTGTCcctttatctct ABRE ctcagtctctctataaacttagtgagaccctcctctgttttactcacaaatatgca Cap signal TATA box Aactagaaaacaatcatcaggaataaagggtttgattacttctattgga Figure 3.16 Nucleotide sequence of...

21
108
0

Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium

Ngày tải lên : 05/09/2013, 14:58

... reviewed a good number of research papers of some International Journals Dr Das is currently acting as the honorary member of editorial board of Indian Journal of Science and Technology and as Referee ... effects of the flow parameters on the velocity and temperature of the flow field and also on the skin friction and the rate of heat transfer have been discussed with the help of Figures 1-5 and Tables ... suction parameter is to enhance the magnitude of both the components of skin friction at the wall A growing suction parameter enhances the rate of heat transfer at the wall, while a growing permeability...

12
493
0

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

Ngày tải lên : 05/09/2013, 15:28

... investigating the relationship between percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and ... Biodiesel of palm has a lower percentage of unsaturation, but still has a longer ignition delay as compared to biodiesel of mahua This may be due to the contribution of stearic acid which is relatively ... 60 70 % of Unsaturation 80 90 Figure Variation of total combustion duration with start of dynamic injection 3.3 Analysis of performance and pollutants emission parameters In this section, the...

20
483
0

Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Ngày tải lên : 05/09/2013, 16:11

... over many other vegetable oils in terms of engine performance, emissions, ease of use and availability Jatropha curcas, locally known as ratanjyot, belongs to the family of Euphorbiaceae It is a ... pp 343-350 D Agarwal and A. K Agarwal Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine Applied Thermal Eng 27 (2007) ... and renewable energy harnessing in international/national journals and conferences He is a life member of Institution of Engineers (India), and life member of Indian Society of Mechanical Engineers...

10
828
1

A study of opening conversation on the phone in english and vietnamese

Ngày tải lên : 26/11/2013, 13:22

... both Vietnamese quantitative and qualitative methods in which qualitative one takes questionnaire These questions are concerned about factors such as: priority so as to analyze data and make them ... acts and the and greetings understanding of languages of nations we interact Telephone conversation opening is an interesting problem not only of social communication but of teaching and learning ... relatively small and then we described, analyzed and made a constrastive analysis to businesses, such as a fishing shop (boat rod and parrot can I help clarify the similarities and differences between...

13
1.1K
2

A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học

Ngày tải lên : 18/12/2013, 10:03

... recommendation for approval or rejection is made to the Australian and New Zealand Food Standards Council (consisting of the Health Ministers of Australia and New Zealand) should not be translated word ... descriptions, contrast and implications for teaching and learning languages made above, I hope that this paper can help students and teachers have better knowledge and correct translations of the passive-meaning ... classification is in great detail Actually the latter four categories are the borderline cases and they are very much related to, and sometimes can be put into the first category As a matter of fact,...

46
1.4K
6

Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf

Ngày tải lên : 23/01/2014, 06:20

... Each new idea should be a new paragraph Typically, a TOEFL/TWE essay will have - body paragraphs C The conclusion: The conclusion will be your final paragraph It will summarize all the main ideas ... restatement says that both a city and town have positive aspects There are many good reasons to live in a big city and an equal number of good reasons to live in a small town You will be writing on these ... responsibility; they can learn the value of money and they can learn how to work as a member of a team When teenagers have jobs while they are students, they can learn how to be responsible As an...

23
784
0

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Ngày tải lên : 15/02/2014, 13:20

... forming a lesion approximately mm in diameter Draining lesions resulting from vaccination should be kept clean and bandaged Scabs form and heal usually within months after vaccination BCG vaccination ... selected persons, and implementation and surveillance of BCG vaccination BCG VACCINES BCG vaccines are live vaccines derived from a strain of Mycobacterium bovis that was attenuated by Calmette and Guérin ... vaccinations are usually administered by the intradermal method, and reactions that can be expected after vaccination include moderate axillary or cervical lymphadenopathy and induration and subsequent...

27
1.3K
3

Tài liệu Cost –Benefit and Usage Behaviour Analysis of No Frills Accounts: A Study Report on Cuddalore District doc

Ngày tải lên : 16/02/2014, 11:20

... taking into account the average usage behaviour of accounts from the transaction data and the market interest rates that prevail 16 S Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour ... 561 Total Table 5.1.1 31 S Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour Analysis of No Frills Accounts transactions and balance maintained - was considered important as it ... Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour Analysis of No Frills Accounts It was observed that no bank except Indian Bank, Vridachalam branch had attempted Information and...

54
462
1

Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

Ngày tải lên : 19/02/2014, 09:20

... with the management of AIF AIFM will be entitled to market AIF to professional investors Authorisation as an AIFM will entitle the manager to market the AIF to professional investors only (as defined ... or between one investor and another that arise in the course of managing one or more AIF AIFM shall maintain and operate effective organisational and administrative arrangements with a view to ... introduces new conditions to address any additional risks to European markets and investors that could arise from such operations It also ensures that national tax authorities may obtain all information...

54
755
0

International consensus recommendations on the aesthetic usage of botulinum toxin type A (Speywood Unit) – part II: wrinkles on the middle and lower face, neck and chest pdf

Ngày tải lên : 07/03/2014, 17:20

... BoNT -A treatment in ´ ´ the decollete area Anatomy The major muscles in the chest area are the caudal part of the platysma and the medial fibres of the pectoralis major The injector can palpate ... Bougara A, Santini J A multicenter, randomized, double-blind, placebo-controlled study of efficacy and safety of doses of botulinum toxin A in the treatment of glabellar lines J Am Acad Dermatol ... injection points (Graph was modified from de Maio and Rzany19) (b) Photographs of a patient at maximal contraction before and 21 days after the treatment with 30 s.U BoNT -A (Speywood Unit) Courtesy of...

11
772
1

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20

... pH range from 5.3 to Tsuruga and Shikama [21] conﬁrmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... the beta chains and that the oxidation of the beta chains was not inﬂuenced by pH The biphasic reaction was shown to consist of a rapid initial reaction followed by a slower second phase over a ... of pH on the auto-oxidation of Hb A0 has been the subject of several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of...

6
748
0

the effect of monetary incentive on effort and task performance a study of vietnamese company

Ngày tải lên : 13/03/2014, 14:20

... Coca-Cola provided Roberto Goizueta, CEO of Coca-Cola, a total of $111.8 million which consisting of annual salary, bonuses, and long-term compensation This was also one of the most well-paid monetary ... of managers and accountants is mainly due to money and they are motivated on performance by monetary incentive H0: The purpose of work of managers and accountants is not mainly due to money and ... compensation program to award managers and accountants a percentage of the company’s accounting profit Proponents of accounting-based bonus plans have demonstrated the common usage of it in many...

89
442
0

Effect of hydrogen peroxide on the destruction of organic contaminants synergism and inhibition in a con

Ngày tải lên : 16/03/2014, 00:07

... mM, and air as the gas phase Plots of percentage conversion of 4-CBA, TOC and (%) CO2 formation based on inﬂuent 4-CBA concentration as a function of (a) inﬂuent hydrogen peroxide concentration, ... peroxide was also applied to reactivate the TiO2 catalyst that suffered deactivation in gas phase photocatalytic reactions due to accumulation of less degradable reaction byproducts [50] The enhancement ... (reaction (18)), which leads to the formation of superoxide radical anion and water (see reactions (16) and 267 (18)), has a reaction rate constant of 2.7 × 107 l mol−1 s−1 [94] The pKa value of...

11
576
0

Báo cáo khoa học: Effects of cardiomyopathic mutations on the biochemical and biophysical properties of the human a-tropomyosin docx

Ngày tải lên : 16/03/2014, 18:20

... AAATACTCTGAAGTACTCAAAGATGCCCAG-3¢), SK TM-1R (5¢-CTGGGCATCTTTGAGTACTTCAGAGTA TTGTC-3¢), SKTM-K70T (5¢-AAAGATGCACAGGAG Muscular actin was puriﬁed from acetone powder of chicken pectoralis major and ... their ability to regulate the actomyosin S1 Mg2+ ATPase activity ATPase activity was ﬁrst assayed by varying the concentration of Tm in the presence of constant concentration of F-actin and myosin ... determinations were carried out in triplicate, and the data are shown as the average ± standard deviation Assay conditions: Tm was dialyzed in 10 mM imidazole, pH 7.0, mM dithiothreitol, and mL samples...

9
603
0