objective by the end of the lesson students will be able to write simple sentences and combine them into a short text about a picnic to the countryside
Giáo án Anh văn lớp 7 : Tên bài dạy : People and places. Lesson 3: B1 - 2. I.Ojectives : -After the lesson Ss will be able to know more docx
Ngày tải lên :
06/08/2014, 15:22
... -Ask Ss retell the name of some countries in the south-east Asia -Work in pairs to discuss and write the answers on the BB Thai land - Laos - Cambodia - Singapore - Indonesia Malaysia ... *Practice - Play the tape again and then read the text to the exercise True- False - Give the correct answers a) False ( Liz knows nothing about General Giap.) b) False ( The People Army of Vietnam ... pairs) *Production -Ask Ss to retell some things about the General Nguyen Van Giap -Work in pairs to discuss -Speak aloud before the class Consolidation: -Ask Ss to retell the main content of...
- 4
- 654
- 1
Unit 3: At home.Period 17: Lesson 4: ReadI. Objectives: - After the lesson, Ss will be able to pptx
Ngày tải lên :
08/08/2014, 02:20
... questions - Ask Ss to give their answers by both only and in writing - Give answers: a Because children often try to eat and drink them b Because the kitchen is a dangerous place c Because playing ... Reading the text - Ss read the text and check their prediction - Ask Ss to correct if the statements are false b, Comprehension questions: - Ask Ss to work in pairs to find out the answers of the ... Slap the board - Ask Ss to read the statements and guess which is true, which is false - Give T/F statements prediction basing on the part in textbook - Give feedback * While- reading: a Reading...
- 4
- 345
- 0
Báo cáo y học: " Restriction by APOBEC3 proteins of endogenous retroviruses with an extracellular life cycle: ex vivo effects and in vivo "traces" on the murine IAPE and human HERV-K elements" pot
Ngày tải lên :
13/08/2014, 05:21
... AAAAATTATACAAAATCCTCAGGAGTCATTCTCAGACTTTGTAGCTAGAATGACAGAGGCAGCAGGCAGAATTTTTGGAGACTCTGAACAGGCAATGCCT .A A A A AA .A ... A HERV-K 7350 7370 7390 7410 7430 ACATGGTAAGCGGGATGTCACTCAGGCCACGGGTAAATTATTTACAAGACTTTTCTTATCAAAGATCATTAAAATTTAGACCTAAAGGGAAACCTTGCCC ch1-1539 ch1-1590 ch3-1029 ch3-1143 ch3-1271 ... were obtained from M Malim (hA 3A) , the NIH AIDS Research and Reference Reagent program (hA3B, hA3C and hA3F), Open Biosystems (hA3DE), A Hance (hA3G), and N Landau (mA3) A plasmid expressing a defective...
- 11
- 277
- 0
The reality of assessing speaking skill of high school students at Nguyen Tat Thanh Gifted High School and recommendations
Ngày tải lên :
10/08/2015, 19:52
... that of a normal one All the above-mentioned factors seem to be advantageous to teaching English speaking in general and the application of the skill assessment in particular In the context of ... triangulated data The class observation may identify gaps between what the teachers say in the interview and what they actually in class The lessons observed were chosen randomly because the ... questions The interviewees were also given the guided questions before hand in the form of a handout for better preparation of ideas and thoughts Because the questions gathered information of a rather...
- 9
- 1.5K
- 17
the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations
Ngày tải lên :
17/02/2014, 13:02
... share, because it allows them to have advantage in price competitive The acquisition of a large competitor is a reasonable way to quickly attain significant market share • Production capacity The ... them to raise a substantial amount of money through increased debt and this will increase the gearing of Jebb plc to a high level Gearing ratio is a term describe a financial ratio that compare ... average of the costs of these sources of financing) as the NPV discount rate is the assumption of an unchanging capital structure In using the WACC, the net advantage of debt capital is taken into account...
- 17
- 575
- 0
Báo cáo hóa học: " Electrical characterisation of deep level defects in Be-doped AlGaAs grown on (100) and (311)A GaAs substrates by MBE" docx
Ngày tải lên :
21/06/2014, 05:20
... carried out DLTS and LDLTS measurements, prepared figures and wrote the first draft MS, MA, AK and MH participated in the analysis of the data and the preparation of the manuscript MH grew the ... experimental data for the traps that obey the Poole-Frenkel model, and the calculated value of Poole-Frenkel constant for each trap are given in Table This study reveals that the number of traps, ... Electrical characterisation of deep level defects in Be- doped AlGaAs grown on (100) and (311 )A GaAs substrates by MBE Nanoscale Research Letters 2011 6:180 Submit your manuscript to a journal and benefit...
- 5
- 334
- 0
Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt
Ngày tải lên :
18/06/2014, 18:20
... mRNA [26,27], and has been the focus of host adaptation and pathogenicity study PB2 mutation, particularly the E627K, has been linked to the adaption of avian viruses to mammalian host [28,29] Another ... worthwhile to further investigate whether this was attributed to the avian origin of the PB2 and PA segments of 2009 pdmH1N1 virus In addition to the avian-origin PB2 and PA, the vRNP of 2009 pdmH1N1 ... RNA (A/ Auckland/1/2009) was kindly provided by Ian G Barr, World Health Organization Collaborating Centre for Reference and Research on Influenza, Australia The study was supported by the Research...
- 15
- 237
- 0
Báo cáo y học: "Spectrocolorimetric assessment of cartilage plugs after autologous osteochondral grafting: correlations between color indices and histological findings in a rabbit model" ppt
Ngày tải lên :
09/08/2014, 10:21
... determined the standard L*, a* and b* values and the standard spectral reflectance ratio of intact articular cartilage in Japanese white rabbits (Figure 1) As a coincidence index for the spectral reflectance ... were cut and then stained with hematoxylin and eosin, toluidine blue and Safranin-O fast green Each section was graded using the histological scale described by Mankin and colleagues [13] (Table ... should be considered First, a total cartilage area of mm in diameter could be measured at one time The measurement area of mm in diameter seems to be too large for the assessment of articular cartilage...
- 9
- 404
- 0
DESIGNING AN END OF YEAR ENGLISH OBJECTIVE TEST FOR 1ST YEAR NON MAJOR ENGLISH STUDENTS OF THE ACADEMY OF FINANCE
Ngày tải lên :
07/09/2013, 13:19
... 1st year non-major English students of the Academy of Finance - The practical recommendations for the appropriate final test to meet the objectives of the course and the need of teachers and students ... persuaded to the agent travel give them a discount C Toni and Jo persuaded the travel agent to give them a discount D Toni and Jo persuaded the agent travel to give them a discount 44 three / manager ... going to be late? 43 the / them / and / to / Jo / discount / Toni / agent / persuaded / a / travel / give /./ A Toni and Jo persuaded the discount to give them a travel agent B Toni and Jo persuaded...
- 44
- 985
- 1
Period 8 UNIT 2: CLOTHING Lesson 2: Speaking I. Aims of the lesson : By the end of the lesson Ss pot
Ngày tải lên :
03/07/2014, 19:20
... 9–i and match them with the at the pictures phrases Remember the - Ask Ss to work in pairs phrases then write - Checks: Kim’s game down on the board - Asks Ss to remember the phrases on page ... usually 10 Ss each to read and write and write more wear on the weekend? more questions for the last questions for the last - I usually wear section of the survey about what section of the survey ... wear these ss wear about the wearing Questions name items note of what you usually wear clothes on the weekend clothes? - Because What is your favorite type of the clothing? Why you wear these...
- 4
- 393
- 0
Period 9 UNIT 2: CLOTHING Lesson 3: Listening I. Aims of the lesson : - By the end of the lesson, potx
Ngày tải lên :
03/07/2014, 19:20
... was last What’s she like? seen near the Answer: main entrance to She is three the Car Fair She was last seen She has short near the main entrance dark hair to the Car Fair She has short dark Ask ... listen to the tape again to Listen to the tape hair check (v) the letter of correct picture again to check (v) Answer: to show Mary is wearing a: B: She is wearing Feed back - evaluation blue short ... Listen to the *Answer the question - Ask Ss to listen to the tape and tape to check the How old is she? check the answers answers Where was she last Feed back - evaluation She is three seen? She was...
- 4
- 975
- 4
Period 10 UNIT 2: CLOTHING Lesson 4: Reading A. Teaching points: By the end of the lesson , pot
Ngày tải lên :
03/07/2014, 19:20
... reading: Reading -Asks Ss to read the text to -Read the text to check *Gap fill check their answers the answers * Gap fill 18 century 1960s students - Asks Ss to read the text Read the text to fill ... jeans at last 3-Because become high fashion clothing? became cheaper Why did the sale of jeans 4-Jeans at last became stop growing? high fashion clothing in jeans the 1980 5 -The sale of jeans ... discuss the question material that was made What was the 60 s’ fashion? in Europe Why old more and more 2 -The people begin wearing in the were embroidered jeans 60’ fashions 1970? painted jeans and...
- 5
- 511
- 0
UNIT 1 : A VISIT FROM A PEN PAL Lesson 2: Speak and Listen I. Aims of the lesson : By the end of pot
Ngày tải lên :
03/07/2014, 19:20
... and ? Where are they going to flowers beautiful? go? What can they on ? What are they doing to do? Listen to the dialogue and Ocean Drive? ? How they get there? check their predition 3.What are ... answer the questions their predition Feed back - individually evaluation Make dialogue and ? Listen again and answer the copy them into questions notebooks Post speaking * Role play Listen Sets the ... the scene: "Tim John' s Mexican pen pal, Carlos is visiting the USA" *They are going to park ? Look at the pictures to *They are *Question given: guess the answering *They an get there Are the...
- 5
- 862
- 0
Giáo án Tiếng Anh lớp 8: Unit 6 The young pioneers club Lesson 2 : Speak A/ Aims and Objectives : By the end of the lesson , pps
Ngày tải lên :
08/08/2014, 02:22
... make the dialogue and move around the class and help Ss - Call on some Ss to practice the dialogue in front of the class V / Homework : Learn by heart the expressions to offer assistance and favor ... pronunciation if any Use appropriate phrases to make similar dialogues about some of the following situations with a partner Practice the - Have Ss work in pairs dialogues in front - Call on ... chorally and then individually all the phrases in the chart Closed pairs III / Practice : Ask Ss to work in pairs to practice the dialogues - Call on some pairs to practice in front of class - Correct...
- 6
- 6.3K
- 13
ENGLISH ADVERBS OF MANNER AND TYPICAL ERRORS MADE BY THE STUDENTS AT LE HONG PHONG SPECIALISED SECONDARY SCHOOL, NAM DINH CITY
Ngày tải lên :
07/09/2013, 13:19
... or a subjunct in the clause * Adverb of manner as an adjunct As an adjunct, the manner adverb can be integrated into the structure of a clause So the manner adjunct is similar in the weight and ... cheating was allowed Also, no explanation by teacher was given on vocabulary or any other things of the test Forty minutes later, all the papers were then gathered by the leader of the class and ... separately The total mark of each paper was the sum of all the individual marks given to all the six tasks For the four first tasks, each correct item was given one mark and no mark was given to...
- 55
- 1.1K
- 8
A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS
Ngày tải lên :
29/01/2014, 00:23
... from marking the tests are ranked according to a scale coded by the researcher and calculated by proportion of students and changed into percentage for data analysis of the study Parts of the test ... Language Teaching (CLT) is an approach to the teaching of second and foreign languages that emphasizes interaction as both the means and the ultimate goal of learning a language CLT places great ... stress, rhythm, intonation, and thought groups These are decisive factors to enable their speaking more natural and understandable In the same way, good pronunciation has a great effect on students ...
- 42
- 1.3K
- 3
Tài liệu cwnaTMCertified Wireless Network AdministratorOfficial Study GuideEndorsed by the Wireless LAN AssociationIndustry Approved!TMExam PW0-100Objective-by-Objective coverage of the CWNA certification examVendor-neutral wireless network trainin pptx
Ngày tải lên :
17/02/2014, 15:20
... Scanning Active Scanning Authentication & Association Authentication Association States of Authentication & Association Unauthenticated and Unassociated Authenticated and Unassociated Authenticated and ... frequency AC electrical signal and when the signal is propagated as radio waves through the air by the antenna Resistance of cables and connectors causes loss due to the converting of the AC signal to ... frequencies are high frequency alternating current (AC) signals that are passed along a copper conductor and then radiated into the air via an antenna An antenna converts/transforms a wired signal to a...
- 390
- 2K
- 2
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2