obd system of engine and a t
A new hybrid treatment system of bioreactors and electrocoagulation for superior removal of organic and nutrient pollutants from municipal wastewater
Ngày tải lên :
13/09/2015, 17:48
... Electrocoagulation at post-treatment The ratio of influent wastewater The ratio of total nitrate to total phosphorus entering anoxic/anaerobic tank Values in the above table is the average values ... with an amount of 120–180 L dayÀ1 The average influent and effluent T- P concentrations, the ratios of CODCr /T- P, T- N /T- P, PO3À -P /T- P of influent, and the NOÀ -N /T- P ratio of total nitrate to total ... also studied; (2) to determine the efficiency of T- N, and T- P removal at different initial concentrations; and (3) to evaluate the efficiency of denitrification and nitrification toward total nitrogen...
- 11
- 565
- 0
Ways of greeting and a comparison between vietnamese and english greetings
Ngày tải lên :
24/12/2013, 09:36
... negotiate role-relationships, peer-solidarity, the exchange of turns in a conversation, the saving of face of both speaker and hearer (7:3) It is clear that a great deal of everyday human interaction ... is often farther than people in many other countries They usually stand out about an arms distance to two feet apart (4;23) This is 30 not always a comfortable distance for the people in countries ... t cá t nh-Vietnamese people habitually like to view and appreciate the communicators age social status, family, job, etc They are interested in the others affairs These characteristics about...
- 37
- 14.2K
- 67
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
Ngày tải lên :
15/02/2014, 01:20
... protein synthesis (i.e eIF 5A, RPLP2 and its mitochondrial paralog L7 ⁄ L12) were less abundant after dopamine treatment, suggesting attenuated translation at both cytoplasmic and mitochondrial ... independent experiments B Fig Activation of the NF-jB pathway (A) NF-jB activity measured by luciferase gene reporter assay after 24 h dopamine treatment (DA) relative to b-gal cells treated with catalase ... those that consistently and significantly varied among the different populations were identified by two-way ANOVA analysis with a threshold of P £ 0.05 using statistixl software (http://www.statistixl.com)...
- 11
- 775
- 0
Đề tài " Analytic representation of functions and a new quasianalyticity threshold " doc
Ngày tải lên :
29/03/2014, 07:20
... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... Gosudarstv Izdat Tehn.-Teor Lit., Moscow, 1950 [S95] F A Shamoyan, Characterization of the rate of decrease of the Fourier coefficients of functions of bounded type and of a class of analytic functions ... not help This ideology also stands behind the proof above To understand why, let K be a nonprobabilistic Cantor set with the same thickness; namely at step n the total length of the 2n intervals...
- 33
- 293
- 0
báo cáo hóa học: " 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside (AICAR) attenuates the expression of LPS- and Aβ peptide-induced inflammatory mediators in astroglia" pptx
Ngày tải lên :
19/06/2014, 22:20
... forward 5'CCTACCCCCAATGTATCCGTTGTG-3' and reverse 5'GGAGGAATGGGAGTTGCTGTTGAA-3'; IL-1β, forward 5'-GAGAGACAAGCAACGACAAAATCC-3' and reverse 5'TTCCCATCTTCTTCTTTGGGTATTG-3'; TNFα, forward 5'CTTCTGTCTACTGAACTTCGGGGT-3' ... 5'CTTCTGTCTACTGAACTTCGGGGT-3' and reverse 5'TGGAACTGATGAGAGGGAGCC-3'; and iNOS, forward 5'-GGAAGAGGAACAACTACTGCTGGT-3' and reverse 5'GAACTGAGGGTACATGCTGGAGC-3' IQTM SYBR Green Supermix was purchased ... A treatment further upregulated this MAP kinase activation (Fig 8D) AICAR treatment down-regulated cytokine /A induced activation of MAP kinases These observations indicate that AICAR activation...
- 21
- 467
- 0
Báo cáo khoa học nông nghiệp " POST HARVEST MANAGEMENT AND NEW APPROACH FOR SUPPLY CHAIN SYSTEM OF CABBAGE AND WATER MELON " doc
Ngày tải lên :
21/06/2014, 04:20
... was the highest with 3.7% compared to other containers It is thought that cabbage in jute bag had mechanical damage due to high loading and vibration That also caused the problem after days of ... Water melon treated with chlorine solution 100 and 150ppm and control + Analysis Spoilage rate were calculated by the ration between spoilage part per total sample for cabbage, and total fruits ... directly on floor of truck with dried straw Tested containers were cartons with window with dried straw + Post harvest treatment - Cabbage were treated with saturated lime and 15% alum and control...
- 5
- 412
- 1
The Legalized Crime of Banking and a constitutional remedy phần 10 pot
Ngày tải lên :
23/07/2014, 19:20
... to the suffering throughout the world — this dream the rest of the world has dreamed in anticipation and yearning that they, too might gain entrance into the United States of America — a dream ... must have if his children eat The astounding thing about Mr Patman is the fact that he ferrets out and makes public these astounding crimes of banking, yet he insists that we have the greatest ... bray them well with the pestle of thought, spread the compound thin on the mortar board, and then cut out a new pattern of life The truest American way of life is carved on the Statue of Liberty:...
- 10
- 439
- 0
The Legalized Crime of Banking and a constitutional remedy phần 9 ppt
Ngày tải lên :
23/07/2014, 19:20
... other agency of the Government, and makes no provision for Congress to re-delegate that great and important function of Government to corporations Read Josiah Stamp's utterances again, and then ... of money; forget the substance we have been calling money; forget all we have read about, the standard of value, of the gold standard; of the silver ratio; of the national credit all of it ... regulate the value thereof." As proof that they had but one conception of money, and that was that it was a medium of exchange, in the same sentence it couched the power to coin money, the Constitution...
- 11
- 421
- 0
The Legalized Crime of Banking and a constitutional remedy phần 8 ppt
Ngày tải lên :
23/07/2014, 19:20
... stream I believe that the Congress could that At least, the oath they take commands them to this If every citizen in the United States would make it a rule to read the Constitution at the breakfast ... conservative, as a democrat or a republican This is not a battle between the rich and the poor It is meeting that standard of the "general welfare" we all subscribe to and proclaim as the goal of America ... against the producing people of the United States That it is unconstitutional for the United States to turn over to a private corporation the "coining of money, and the regulating the value thereof,"...
- 16
- 317
- 0
The Legalized Crime of Banking and a constitutional remedy phần 7 pptx
Ngày tải lên :
23/07/2014, 19:20
... the total deposits equal to the total cost of carrying on business as the years passed They would this by adding deposits as often as the total demands of business was greater than total deposits ... instalments, all financial facts, I would come up with the answer; and I would by actual figures show that in actual deeds or instalment obligations against all real estate, all industry, all transportation, ... "Treasury Note" would replace "Federal Reserve Note, and The Treasury of the United States of America would appear instead of The United States of America The picture of a man’s head would disappear,...
- 18
- 481
- 0
The Legalized Crime of Banking and a constitutional remedy phần 6 doc
Ngày tải lên :
23/07/2014, 19:20
... the cash out and hand it to him, is immaterial The fact remains, as admitted by the Reserve book, that someone must write a cheque and present it to his bank, before cash can leave the bank And ... treasury and the banks arrive at a total volume of money; we should as the total of all companies' travellers and money orders, also total p.o money orders, to arrive at a grand total, for these are ... them, and they at once stopped the pumps pumping deposits into the deposit totals, and hastily started to siphon it out of the hands of the average man They did this in 1955, and gradually economic...
- 4
- 326
- 0
The Legalized Crime of Banking and a constitutional remedy phần 5 pot
Ngày tải lên :
23/07/2014, 19:20
... United States on the interpretation of the Constitution of the United States of America: (a) those who contend that we should obey the letter of the Constitution; (b) those who contend that we ... capital That is true private capital, and the: person who created it has a perfect social right to use it as he pleases It is honest capital It represents wealth which he has created It will always ... Crime of Banking But still too stiff-necked to admit that you are a slave to them because you are too lazy to think it through, or too much of a coward to stand up and face their jibes and reprisal?...
- 25
- 382
- 0
The Legalized Crime of Banking and a constitutional remedy phần 4 docx
Ngày tải lên :
23/07/2014, 19:20
... When as a matter of fact, they tell the Government what it can and never bother about what the Government may think about what they These 19 men had put on the squeeze, and today the little fellow ... is an axiom in equity and human understanding that any law that a common citizen, with a reasonable ability to read, cannot understand is a bad law Suppose the Coach wrote a set of rules of the ... (The total obligations to any national banking association of any person, co-partnership, association, or corporation shall at no time exceed 10 percentum of the amount of the capital stock of...
- 15
- 433
- 0
The Legalized Crime of Banking and a constitutional remedy phần 3 pptx
Ngày tải lên :
23/07/2014, 19:20
... Federal Reserve Act, bankers, private corporations formed strictly for private gain, use the credit of the United States (its vast natural and material resources, its vast industrial and commercial ... out (or received by each and all Depositories in the Nation) , and where the deposits are, Depository to Depository, and ,the grand total of these each day must be the same as the grand total of ... Andy let Nick taunt him into killing the Second Bank of the United States, first in small quantities, as Gold and Silver Even at that late date coins were shuttling about in an effort to meet the...
- 15
- 394
- 0
The Legalized Crime of Banking and a constitutional remedy phần 2 pot
Ngày tải lên :
23/07/2014, 19:20
... instead of my loan agreement calling for my payment in instalments of $400 and interest, it called for a total payment of $676 in instalments,” and that loan agency is a department of an Austin ... value thereof, and of foreign coin, and fix the standard of weights and measures And in Section 10: “No state shall enter into any treaty, alliance, or confederation, grant letters of marque and ... passed monetary laws without giving a great deal of attention to them, being told (by bankers who had written the bills) that money was (is) a mystery and that few people understood it and those...
- 13
- 517
- 0
The Legalized Crime of Banking and a constitutional remedy phần 1 ppsx
Ngày tải lên :
23/07/2014, 19:20
... about a situation, I shall go into repetitious details, and cite many instances of the practices of bankers, that you may know that indeed you are the slaves of the bankers, and “pay the cost of ... the money that they paid for them did they not? Mr Eccles: “That is the function of a bank When a bank makes a loan to a utility, or a farmer, it creates the money that it lends at the time the ... forget that there is a great deal of difference between a moral wrong and a legal right.” And maybe you have a true picture of banking and its evils, and say with Sir Josiah Stamp, “ but as long...
- 16
- 393
- 0
Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc
Ngày tải lên :
12/08/2014, 04:20
... of the CTMP-7 gene respectively: 5'-GGATCCCGCAGGCCAAAGACAACAATAGT GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAAACTAGTTACCAGATCATAACAACCCTCA AGAGGGTTGTTATGATCTGGTAACTAGTTTCA ... 5'- GAGACAATCGCGAACATCTAC -3', 5'- ATTCCACCCGCA TGGAGTTC -3' and 5'- CGGTGATGTTCGTCAGGACC -3', respectively Reactions were run in a 96-well format in an ABI Prism 7500 with the following conditions: ... with anti-CTMP-7 antibody and antiVP26 antibody (Fig 1c) Analysis of the CTMP-7 - VP26 interaction by β-gal activity assay suggested that the interaction involved the C-terminal portion of CTMP-7...
- 12
- 302
- 0
Báo cáo y học: " Significant receptor affinities of metabolites and a degradation product of mometasone furoate" pdf
Ngày tải lên :
12/08/2014, 18:21
... data We strongly suggest a clinical trial that determines both efficacy and safety in parallel as well as all known AV carried out all experiments and the data analysis and participated in the ... asthma therapy all share the safety relevant property of extensive metabolism and formation of inactive metabolites For MF, however, data was sparse so far Though putative metabolites and degradation ... to plastic material Samples were incubated at 37°C in a shaking water bath At designated time intervals samples of 1.0 ml were removed, subjected to a fluid extraction with diethylether and analyzed...
- 6
- 258
- 0
An investigation into the system of theme and rheme in electronic news headlines the case of BBC news headlines = Cấu trúc đề thuyết trong tiêu đề báo điện tử -.PDF
Ngày tải lên :
28/03/2015, 09:39
... quantitative analysis, in that things are counted It is, however, not merely a statistical analysis; the quantitative data is used as a basis for interpretation The study is based on the theory of systemic ... (1994:284), theme analysis is best undertaken after analysing the clause for its transitivity system Therefore, besides textual meaning, the author also carried out the analysis of another strand of meaning, ... of those due to the limitation of time and limited number of pages, it only focuses on the last mentioned category, theme as message onset This thesis attempts to investigate the system of theme...
- 12
- 829
- 3
An Investigation into the System of Theme and Rheme in Electronic
Ngày tải lên :
10/08/2015, 19:49
... quantitative analysis, in that things are counted It is, however, not merely a statistical analysis; the quantitative data is used as a basis for interpretation The study is based on the theory of systemic ... (1994:284), theme analysis is best undertaken after analysing the clause for its transitivity system Therefore, besides textual meaning, the author also carried out the analysis of another strand of meaning, ... Denardi, D A C (2010) Cohesion and Thematic Structure: A SFL-Based Analysis of Academic Abstracts Master's thesis Federal University of Santa Catarina Dodds, J A (1982) "The Thematic Structure of...
- 7
- 604
- 5