not all control paths return a value

Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

Ngày tải lên : 12/09/2012, 22:48
... parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter names match other variable names in the program  Remember that only ... the formal parameter names  Formal parameters are like placeholders for the actual arguments used when the function is called  Formal parameter names can be any valid identifier Example: double ... the calculation or  expression is a variable containing the calculated value Example: return subtotal + subtotal * TAX_RATE; Copyright © 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley...
  • 94
  • 541
  • 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Ngày tải lên : 26/10/2012, 09:48
... liver cancer, pancreas cancer, lung cancer cancers, and cancers on the minor sites, whereas the equivalence is uncertain for bladder cancer and prostate cancer although all showed no statistically ... death certificate Third, social class, which is also associated with both smoking and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and ... spouse control design as an alternative control selection for a nationwide population-based case -control study is valid and feasible, and can produce highly acceptable research results for a fixed...
  • 9
  • 532
  • 1
Using a DataGrid Control to Access a Database

Using a DataGrid Control to Access a Database

Ngày tải lên : 07/11/2013, 10:15
... the Data Adapter Preview dialog box Next, you need to create a DataSet object You use a DataSet object to a store local copy of the information stored in the database A DataSet object can represent ... a SqlConnection object named sqlConnection1 and a SqlDataAdapter object named sqlDataAdapter1, as shown in Figure 6.10 Figure 6.10: Form with SqlConnection and SqlDataAdapter objects Click your ... Note You could also call the Fill() method in the Form1_Load event This event occurs when the form is initially loaded Next, add another button that will allow you to save any changes you make...
  • 8
  • 486
  • 0
Tài liệu CHAPTER 65 AIR POLLUTION-CONTROL TECHNOLOGIES C. A. Miller United States Environmental Protection ppt

Tài liệu CHAPTER 65 AIR POLLUTION-CONTROL TECHNOLOGIES C. A. Miller United States Environmental Protection ppt

Ngày tải lên : 17/12/2013, 14:15
... of a catalyst, and at lower temperatures (usually around 315-37O0C [600-70O0F]) than SNCR systems Catalysts are typically titanium- and/or vanadiumbased, and are installed in the flue gas streams ... including cyanuric acid, ammonium sulfate, ammonium carbamate, and hydrazine hydrate A number of proprietary reagents are also offered by several vendors, but all rely on similar chemical reaction ... fuel and air and, if adequate furnace lengths are not available, impingement of the flame on the opposite wall can lead to rapid cooling of the flame and therefore increased emissions of CO and...
  • 19
  • 400
  • 0
Tài liệu COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS A Primer for the SkillsUSA/VICA Championships Steve docx

Tài liệu COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS A Primer for the SkillsUSA/VICA Championships Steve docx

Ngày tải lên : 25/12/2013, 05:16
... have as many CDCs available as there are tool pockets in the tool storage matrix The advantage of the CDC feature is that it: allows the use of cutters that have been sharpened to a smaller diameter ... of education and technical training The Novamill is controlled via a standard keyboard or Desk-Top Tutor connected to a PC An optional station Automatic Tool Changer (ATC) is also available (Denford ... interpolation, and most controls are capable of both linear and circular interpolation Helical, parabolic, and cubic interpolation are used by industries that manufacture parts which have complex shapes,...
  • 51
  • 501
  • 1
Control systems design  a new framework

Control systems design a new framework

Ngày tải lên : 01/01/2014, 18:49
... means of several criteria that have to be satisfied simultaneously Finding an appropriate way of representing such criteria mathematically has been a challenge 20 Vladimir Zakian The approach ... change is simply to treat all performance objectives mathematically in the same way the constraints are formulated But, as is well known, a change in a single axiom of a mathematical system can ... greatly elaborated and generalised, and now contains many design methods that are essentially equivalent However, it remains, in essence, a practical approach to design and it gained acceptance...
  • 400
  • 370
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk...
  • 12
  • 616
  • 0
Hybrid Control Design for a Wheeled Mobile RobotThomas Bak 1 docx

Hybrid Control Design for a Wheeled Mobile RobotThomas Bak 1 docx

Ngày tải lên : 22/03/2014, 11:20
... the approach taken in [5] and [6] Based on this nonlinear model, we design a path tracking control law based on feedback linearization Feedback linearization designs have the potential of reaching ... systems) A straightforward analysis will show that the system can always be rendered unstable: Just vary the reference input such that transitions are always taken before the transition safe state ... singularities in the feedback linearization control law of a ball-and-beam system is treated by switching to an approximate control scheme in the vicinity of the singular points in state space...
  • 16
  • 362
  • 0
BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc

BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc

Ngày tải lên : 24/03/2014, 04:21
... Installation of BIM and Forecast Installation Post-installation tasks Configuring BIM web interface Installation of Control Modules Pre-installation considerations Installation – Control- M for database ... one-size-fits -all approach, as there are chances that the events rather need a human decision to take place This approach can free the user from repetitive tasks, but can also increase maintenance overhead, ... that, applications that are specialized in a particular area may also require batch processing Some of these applications such as PeopleSoft Finance and SAP R/3 had to come with an in-built batch...
  • 534
  • 1.7K
  • 0
All the World’s a Cage: Animal Entertainment pdf

All the World’s a Cage: Animal Entertainment pdf

Ngày tải lên : 30/03/2014, 14:20
... orphan brought back by the Davis family from a vacation in Africa The story didn’t share that almost all baby chimps acquired from Africa are orphans As with elephants and orcas, a living mother ... February 2005, St James Davis was at the Animal Haven Ranch visiting Moe, a chimp he had raised from a baby but had been forced to give up after the chimp bit off a neighbor’s finger During Davis’s ... billed as “the Missing Link,” or as a “humanzee,” the billing due mostly to his humanlike two-legged walk He also had less facial hair and what is considered to be a more human-shaped head than most...
  • 5
  • 492
  • 0
agile analytics a value-driven approach to business intelligence and data warehousing

agile analytics a value-driven approach to business intelligence and data warehousing

Ngày tải lên : 29/05/2014, 13:56
... Analysis Visualizaion Reports ETL OLAP Flat Files EII External Data Scorecards & Dashboards Data Marts Metadata Management Figure 1.1 Classical data warehouse architecture Data Mining 14 CHAPTER INTRODUCING ... reality the data model was a replication of parts of one of the legacy operational databases This replicated database did not include any data scrubbing and was wrapped in a significant amount of ... operational data store or an enterprise information integration (EII) repository that acts as a system of record for all relevant operational data The integration database is typically based on a...
  • 366
  • 1.1K
  • 1
paths to a green world the political economy of the global environment

paths to a green world the political economy of the global environment

Ngày tải lên : 01/06/2014, 10:55
... Cooperation NAFTA North American Free Trade Agreement NASA National Aeronautics and Space Administration NGO Nongovernmental organization NIEO New International Economic Order xx Acronyms ODA Official ... Multilateral Environmental Agreement MFN Most favored nation MIGA Multilateral Investment Guarantee Agency MMPA Marine Mammal Protection Act (U.S.) NAAEC North American Agreement on Environmental Cooperation ... Joshua Gordon, Jeca Glor-Bell, and Sanushka Mudaliar also helped immeasurably with the research We are grateful to the Australian Research Council and the Social Sciences and Humanities Research...
  • 353
  • 651
  • 0
the mit press paths to a green world the political economy of the global environment apr 2005

the mit press paths to a green world the political economy of the global environment apr 2005

Ngày tải lên : 11/06/2014, 12:44
... Cooperation NAFTA North American Free Trade Agreement NASA National Aeronautics and Space Administration NGO Nongovernmental organization NIEO New International Economic Order xx Acronyms ODA Official ... potential counterbalances to 26 Chapter globalization that help citizens to “think globally and act locally.” E-mail and the Internet are also cheap and effective tools of antiglobalization activists, ... Joshua Gordon, Jeca Glor-Bell, and Sanushka Mudaliar also helped immeasurably with the research We are grateful to the Australian Research Council and the Social Sciences and Humanities Research...
  • 337
  • 769
  • 0
báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc

báo cáo sinh học:" Sustainable scaling up of good quality health worker education for tuberculosis control in Indonesia: a case study" doc

Ngày tải lên : 18/06/2014, 17:20
... made available through United States Agency for International Develop- Table 1: Regional training centres Centre Region Padang Makasar Murna Jati Ciloto West Sumatra South Sulawesi East Java ... towards global TB control targets a progress that has been sustained despite many challenges It is also clear that without the substantial amounts of external funding that were gradually made available ... NTP, as well as the systematic approach to establishing an organizational structure at all levels for HRD and the standardization of training materials and procedures The importance of having...
  • 9
  • 417
  • 0
Báo cáo hóa học: " Characterization of age-related modifications of upper limb motor control strategies in a new dynamic environment" docx

Báo cáo hóa học: " Characterization of age-related modifications of upper limb motor control strategies in a new dynamic environment" docx

Ngày tải lên : 19/06/2014, 08:20
... elderly and young groups in adaptation and de- adaptation phases MT E values MT E values for elderly and young groups in adaptation and de- adaptation phases Bottom side: after the removal of the ... producing a MUSC E torque larger than necessary and maintained this attitude also in the relearning phase, so that movements were characterized by larger acceleration and velocity, probably at the base ... The analysis of elderly end point trajectories during the early adaptation and de-adaptation phases showed the presence of after-effects, demonstrating that aging does not affect the capability...
  • 14
  • 304
  • 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

Ngày tải lên : 21/06/2014, 06:20
... stability criteria have been given in terms of a set of linear matrix inequalities, and stabilization periodically intermittent state feedback controllers are proposed Finally, a numerical example ... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... 0, ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System...
  • 13
  • 444
  • 0
It hurts to love someone and not be loved in return pdf

It hurts to love someone and not be loved in return pdf

Ngày tải lên : 21/06/2014, 11:20
... 18) A careless word may kindle strife; a cruel word may wreck a life; a timely word may level stress; a loving word may heal and bless 18) Một lời nói vô ý nhóm lên xung đột; lời nói độc đ a phá ... 23) The brightest future will always be based on a forgotten past, you can't go on well in life until you let go of your past failures and heartaches 23) Tương lai tươi sáng đến từ khứ bị lãng ... biệt 15) Dream what you want to dream; go where you want to go; be what you want to be, because you have only one life and one chance to all the things you want to 15) Cứ mơ bạn muốn mơ; đến nơi...
  • 2
  • 436
  • 0
Báo cáo hóa học: " A Sigma-Delta ADC with Decimation and Gain Control Function for a Bluetooth Receiver in 130 nm Digital CMOS" pdf

Báo cáo hóa học: " A Sigma-Delta ADC with Decimation and Gain Control Function for a Bluetooth Receiver in 130 nm Digital CMOS" pdf

Ngày tải lên : 22/06/2014, 22:20
... matching can be easily achieved without dramatically increasing unit capacitance Based on behavioral-level simulations, the minimum allowable capacitance value was chosen Six-phase clock signals ... FIR sampling block by adding the high-gain-mode switched capacitor in parallel with each of the capacitors in Figure An alternative of adding the capacitance in the amplifier feedback is not the ... substrate and supply rails was carefully considered as an important design and layout parameter Layout considerations are also very critical, since any component mismatch could result in degradation...
  • 8
  • 280
  • 0
Báo cáo hóa học: " ITERATIVE SCHEMES WITH SOME CONTROL CONDITIONS FOR A FAMILY OF FINITE NONEXPANSIVE MAPPINGS IN BANACH SPACES" docx

Báo cáo hóa học: " ITERATIVE SCHEMES WITH SOME CONTROL CONDITIONS FOR A FAMILY OF FINITE NONEXPANSIVE MAPPINGS IN BANACH SPACES" docx

Ngày tải lên : 23/06/2014, 00:20
... modifications, by many authors [4, 13, 18, 22] In 1997, Jung and Kim [9] extended Bauschke’s result to a Banach space and Shioji and Takahashi [19] improved Wittmann’s result to a certain Banach space ... all y ∈ E with y = x It is well known that if E admits a weakly sequentially continuous duality mapping, then E satisfies Opial’s condition Recall that a mapping T defined on a subset C of a Banach ... nonexpansive non-linear mappings in Banach spaces, Arch Rational Mech Anal 24 (1967), 82–90 Y J Cho, S M Kang, and H Zhou, Some control conditions on iterative methods, Comm Appl Nonlinear Anal...
  • 11
  • 305
  • 0