nghiên cứu biểu hiện gen trehalase tái tổ hợp ở e coli và xác định các tính chất của enzyme

Nghiên cứu biểu hiện gen Trehalase tái tổ hợp E.coli xác định các tính chất của enzyme

Nghiên cứu biểu hiện gen Trehalase tái tổ hợp ở E.coli và xác định các tính chất của enzyme

Công nghệ - Môi trường

... E. coli xác định tính chất enzyme Mục tiêu đề tài: Biểu gen Trehalase tái tổ hợp E. coli Tách tinh chế enzyme Xác định đặc tính enzyme Ứng dụng enzyme để tổng hợp Trehalose Khoa Công Nghệ Sinh ... Mở Vì vậy, việc nghiên cứu sản xuất enzyme Trehalase ý nghĩa khoa học mà có giá trị kinh tế xã hội Từ lý thực đề tài nghiên cứu sau: Nghiên cứu biểu gen Trehalase tái tổ hợp E. coli xác định tính ... Disaccharide thủy phân vào phân tử glucose enzyme Trehalase Có loại Trehalase tìm thấy Saccharomyces cerevisiae (nấm men), Trehalase trung tính (NT )và Trehalase axit (AT) phân loại dựa vào độ pH...
  • 33
  • 767
  • 1

Nghiên cứu biểu hiện gen mã hóa kháng nguyên bề mặt của trypanosoma evansi ứng dụng kháng nguyên tái tổ hợp để sản xuất kít chẩn đoán bệnh tiên mao trùng gia súc

Nghiên cứu biểu hiện gen mã hóa kháng nguyên bề mặt của trypanosoma evansi và ứng dụng kháng nguyên tái tổ hợp để sản xuất kít chẩn đoán bệnh tiên mao trùng ở gia súc

Nông - Lâm - Ngư

... (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Fementas (Mỹ) Sigma (Mỹ) Eco RI Hind III Fementas ... nghiên cứu 2.4.1 Sơ đồ nghiên cứu Lên men: (xác định điều kiện lên men chủng tái tổ hợp: IPGT, pH, t0C) Tách tinh protein tái tổ hợp Đánh giá tính kháng nguyên Protein tái tổ hợp gen RoTAT 1.2 Xây ... protein tái tổ hợp E. coli Có nhiều chủng vi khuẩn E. coli sử dụng biểu gen chủng E. coli BL21 chủng E. coli ưa chuộng sử dụng rộng rãi để biểu loại gen khác 35 Tuy nhiên có hạn chế sau: Các gen mã hóa...
  • 81
  • 1,050
  • 0

Nghiên cứu biểu hiện gen mã hóa kháng nguyên bề mặt của trypanosomaevansi ứng dụng kháng nguyên tái tổ hợp để sản xuất kít chẩn đoán bệnh tiên mao trùng gia súc

Nghiên cứu biểu hiện gen mã hóa kháng nguyên bề mặt của trypanosomaevansi và ứng dụng kháng nguyên tái tổ hợp để sản xuất kít chẩn đoán bệnh tiên mao trùng ở gia súc

Khoa học tự nhiên

... biểu protein tái tổ hợp E coli Có nhiều chủng vi khuẩn E coli sử dụng biểu gen chủng E coli BL21 chủng E coli ưa chuộng sử dụng rộng rãi để biểu loại gen khác Tuy nhiên có hạn chế sau: Các gen ... ADN – polymerase Fementas (Mỹ) Pfu turbo ADN polymerase Fementas (Mỹ) Peptone Fementas (Mỹ) Yeast Extract Fementas (Mỹ) Nacl, NaOH, MgSo4, MgCl2, glycerol, CaCl2 Fementas (Mỹ) Agar Fementas (Mỹ) ... khuẩn tái tổ hợp gen ROTAT 1.2 Lên men: (xác định điều kiện lên men chủng tái tổ hợp: IPGT, pH, t0C) Tách tinh protein tái tổ hợp Đánh giá tính kháng nguyên Protein tái tổ hợp gen RoTAT 1.2 Xây...
  • 79
  • 362
  • 0

Nghiên cứu biểu hiện gen mã hóa kháng nguyên GP 120 của virus HIV phân type B lưu hành tại Việt Nam

Nghiên cứu biểu hiện gen mã hóa kháng nguyên GP 120 của virus HIV phân type B lưu hành tại Việt Nam

Y khoa - Dược

... vào vector • Biến nạp DNA plasmid vào tế bào E. coli • Cắt DNA enzyme giới hạn • Xác định trình tự gen máy giải trình tự gen tự động • Biểu gen tế bào E. coli tái tổ hợpTinh protein tái tổ hợp ... Western Blot 2+ KẾT QUẢ THẢO LUẬN Thiết kế vector biểu pET32a(+) mang gen gp120B Khuếch đại gen gp120B_EX cặp mồi biểu ĐC1: Thang DNA chuẩn 1kb ĐC2: sản phẩm PCR Tạo vector tái tổ hợp pET32a(+) ... (đoạn gen gp120B_EX) Tinh DNA plasmid ĐC1-3: Tương ứng với dòng plasmid tái tổ hợp số 4, 10, 12 Gen gp120B_EX vector biểu pET32a(+) giải trình tự Kiểm tra khung đọc gen gp120B vector pET32a(+) Biểu...
  • 44
  • 948
  • 2

Nghiên cứu biểu hiện gen mã hóa kháng nguyên gp120 của virus HIV phân type b lưu hành tại việt nam

Nghiên cứu biểu hiện gen mã hóa kháng nguyên gp120 của virus HIV phân type b lưu hành tại việt nam

Sinh học

... 2.3.9 Xác định trình tự gen máy giải trình tự gen tự động Theo Frederick Sanger, nguyên tắc phương pháp Dideoxy dựa vào hoạt động enzyme DNA polymerase trình tổng hợp DNA Enzyme DNA polymerase xúc ... Sequencer (Applied Biosystems-Mỹ) với kit xác định trình tự BigDye® Terminator v3.1 Cycle Sequencing (Applied Biosystems) Quy trình tiến hành theo phụ lục 2.3.10 Biểu gen tế bào E. coli tái tổ ... Polyvinylidene difluoride RNA Ribonuclecin Acid SDS Sodium dodecyl sulphat SDS-PAGE Sodium dodecyl sulphat-Polyacrylamide gel electrophoresis TAE Tris-Acetate-EDTA Taq Thermus aquaticus TBS Tris Buffered...
  • 68
  • 576
  • 0

ĐỀ TÀI: Nghiên cứu biểu hiện gen mã hóa kháng nguyên bảo vệ PA của vi khuẩn bacillus anthracis

ĐỀ TÀI: Nghiên cứu biểu hiện gen mã hóa kháng nguyên bảo vệ PA của vi khuẩn bacillus anthracis

Y khoa - Dược

... hưởng tới vùng liên kết với LF [21] V Biểu gen pagA Hệ thống biểu 1.1 Vector biểu Vector biểu gen (expression vector) vector tách dòng mang promoter mạnh, cho phép biểu đồng thời gen thị gen ... khiển biểu gen gây độc vi khuẩn B anthracis Người ta xác định có hai nhân tố điều hoà dịch mã biểu gen atxA acpA Gen acpA nằm plasmind pXO2 hoạt hoá biểu gen capB (mét gen mã hoá vỏ capsule) Gen ... Đưa gen vào vector biểu biến nạp vào tế bào E coli DH5α 31 Lê Thu Trang 04-04 Khóa luận tốt nghiệp  Bước 8: Tách plasmid từ thể biến nạp E coli kiểm tra gen đặc biệt chiều gen vector biểu Gen...
  • 69
  • 286
  • 0

NGHIÊN CỨU BIỂU HIỆN GEN MÃ HÓA CHẤT HOẠT HÓA PLASMINOGEN MÔ CỦA NGƯỜI TRONG VI KHUẨN Echerichia coli

NGHIÊN CỨU BIỂU HIỆN GEN MÃ HÓA CHẤT HOẠT HÓA PLASMINOGEN MÔ CỦA NGƯỜI TRONG VI KHUẨN Echerichia coli

Thạc sĩ - Cao học

... ctgtgcgggggcatactcatcagctcctgctggattctctctgccgcccactgcttccag LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln ... Dideoxynucleoside triphosphate PA Chất hoạt hóa plasmingen (Plasminogen activator) DNA Deoxyribonucleic acid PAI dNTP Deoxynucleoside triphosphate PCR E coli Escherichia coli rDNA EDTA Ethylene Diamine ... SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly...
  • 65
  • 720
  • 3

Nghiên cứu biểu hiện gen Paga mã hóa kháng nguyên bảo vệ PA của vi khuẩn Bacillus anthracis trong vi khuẩn E. Coli BL21

Nghiên cứu biểu hiện gen Paga mã hóa kháng nguyên bảo vệ PA của vi khuẩn Bacillus anthracis trong vi khuẩn E. Coli BL21

Y dược - Sinh học

... plasmid tái tổ hợp 55 3.4.3.3 Kiểm tra khung đọc vector tái tổ hợp pET-TRX-FUS-pagA 57 3.4.3.4 Biến nạp plasmid tái tổ hợp pET-TRX-pagA vào E coli BL21 (DE3) 58 3.4.4 Nghiên cứu biểu gen pagA E coli ... biến nạp E coli kiểm tra gen đặc biệt chiều gen vector biểu Gen cần biểu phải nằm chiều promoter Bước 9: Biến nạp vector biểu có mang gen vào tế bào chủ E coli tiến hành biểu Sau tiến hành biểu thành ... IV ảnh hưởng tới vùng liên kết với LF [21] 1.5 Biểu gen pagA 1.5.1 Vector biểu Vector biểu gen (expression vector) vector tách dòng mang promoter mạnh, cho phép biểu đồng thời gen thị gen tách...
  • 78
  • 464
  • 0

NGHIÊN CỨU BIỂU HIỆN GEN MÃ HÓA P24 CỦA HIV-1 PHÂN TYPE AE CỦA BỆNH NHÂN HÀ NỘI EXPRESSION OF GENE ENCODING P24 ppt

NGHIÊN CỨU BIỂU HIỆN GEN MÃ HÓA P24 CỦA HIV-1 PHÂN TYPE AE CỦA BỆNH NHÂN Ở HÀ NỘI EXPRESSION OF GENE ENCODING P24 ppt

Báo cáo khoa học

... Principle of Protein-Dye Binding Anal Biochem 72:248-254 [4] Towbin, H et al (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications ... mang loại bỏ hiệu khỏi protein tái tổ hợp nồng độ vecter tái tổ hợp cảm ứng IPTG imidazol 50 mM Sau protein tái tổ hợp đẩy khỏi cột nhờ buffer đẩy (Native Elution Buffer), thu phân đoạn, phân đoạn ... A: phản ứng protein tái tổ hợp với huyết dương tính, B: phản ứng p24 tái tổ hợp với huyết âm tính ĐC M: Protein chuẩn; ĐC 1, 3: Protein tái tổ hợp p24; ĐC 2, 4: Protein Thioredoxin 376 Tuyển...
  • 7
  • 403
  • 0

đồ án tốt nghiệp nghiên cứu biểu hiện gen mã hóa chất hoạt hóa plasminogen mô của người trong

đồ án tốt nghiệp nghiên cứu biểu hiện gen mã hóa chất hoạt hóa plasminogen mô của người trong

Điện - Điện tử - Viễn thông

... ctgtgcgggggcatactcatcagctcctgctggattctctctgccgcccactgcttccag LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln ... Dideoxynucleoside triphosphate PA Chất hoạt hóa plasmingen (Plasminogen activator) DNA Deoxyribonucleic acid PAI dNTP Deoxynucleoside triphosphate PCR E coli Escherichia coli rDNA EDTA Ethylene Diamine ... SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly...
  • 65
  • 382
  • 0

ĐỀ TÀI: Nghiên cứu biểu hiện gen mã hóa kháng nguyên bảo vệ PA của vi khuẩn Bacillus Anthracis

ĐỀ TÀI: Nghiên cứu biểu hiện gen mã hóa kháng nguyên bảo vệ PA của vi khuẩn Bacillus Anthracis

Y khoa - Dược

... hưởng tới vùng liên kết với LF [21] V Biểu gen pagA Hệ thống biểu 1.1 Vector biểu Vector biểu gen (expression vector) vector tách dòng mang promoter mạnh, cho phép biểu đồng thời gen thị gen ... khiển biểu gen gây độc vi khuẩn B anthracis Người ta xác định có hai nhân tố điều hoà dịch mã biểu gen atxA acpA Gen acpA nằm plasmind pXO2 hoạt hoá biểu gen capB (mét gen mã hoá vỏ capsule) Gen ... Đưa gen vào vector biểu biến nạp vào tế bào E coli DH5α 31 Lê Thu Trang 04-04 Khóa luận tốt nghiệp  Bước 8: Tách plasmid từ thể biến nạp E coli kiểm tra gen đặc biệt chiều gen vector biểu Gen...
  • 69
  • 322
  • 0

Nghiên cứu biểu hiện gen GerF trong nhóm gen sinh tổng hợp gốc đường khử dTDP-6deoxy-D-Allose của cấu trúc kháng sinh Dihydrochalcomycin.

Nghiên cứu biểu hiện gen GerF trong nhóm gen sinh tổng hợp gốc đường khử dTDP-6deoxy-D-Allose của cấu trúc kháng sinh Dihydrochalcomycin.

Quản trị kinh doanh

... Nhóm gen deoxysugar tham gia sinh tổng hợp dihydrochalcomycin Cơ chế: Enzyme gerF (dTDP-4-keto-6-deoxyglucose 3-epimerase) với tương tác enzyme gerK1(dTDP-4-keto-6-deoxyglucose reductase) tạo ... gen dự đoán tham gia sinh tổng hợp đường D-mycinose trình tổng hợp kháng sinh dihydrochalcomycin gồm gen là: gerD, gerE, gerF, gerK, gerM2, gerM3 (hình 4)[20] Trong gerF gen mã hóa cho enzyme ... chức gen gerF sinh tổng hợp gốc đường khử dTDP- mycinose thành phần quan trọng cấu trúc kháng sinh dihydrochalcomycin 1.7 Enzyme giới hạn Enzyme giới hạn( Restriction enzyme, RE) enzyme Endonuclease...
  • 49
  • 319
  • 0

Nghiên cứu biểu hiện gen NovU tham gia sinh tổng hợp đuờng khử dTDP–L–Noviose thuộc nhóm gen sinh tổng hợp kháng sinh Novobiocin

Nghiên cứu biểu hiện gen NovU tham gia sinh tổng hợp đuờng khử dTDP–L–Noviose thuộc nhóm gen sinh tổng hợp kháng sinh Novobiocin

Quản trị kinh doanh

... 3,5–epimerase mã hóa NovW Bước trình sinh tổng hợp Noviose trình methyl hóa C5 enzyme 5–methyltransferase mã hóa NovU, khử C4 cacbonyl cacbon thể enzyme 4–ketoreductase mã hóa NovS enzyme O–methyltransterase ... Streptomyces roseochromogenes sub sp., Streptomyces caeruleus Trong cosmid (9–6G) cung cấp, gen NovU có độ dài 1.2 kb Theo dự đoán đường sinh tổng hợp đường Noviose gen NovU có chức C–Methyltransferase, ... tài: "Nghiên cứu biểu gen NovU tham gia sinh tổng hợp đuờng khử dTDP–L–Noviose thuộc nhóm gen sinh tổng hợp kháng sinh Novobiocin" Mục tiêu đề tài kiểm tra vector tái tổ hợp có chứa gen NovU nghiên...
  • 47
  • 397
  • 0

Nghiên cứu biểu hiện gen mã hóa asparaginase của aspergillus oryzae trong nấm men pichia pastoris

Nghiên cứu biểu hiện gen mã hóa asparaginase của aspergillus oryzae trong nấm men pichia pastoris

Khoa học tự nhiên

... Buffered Minimal Glycerol Yeast BMMY Buffered Minimal Methanol Yeast bp Base pair dNTP 2’- deoxyribonucleotide 5’ – triphosphate EDTA Ethylene diamine tetra acetic acid ETBr Ethidium bromide E coli ... Y proteinase 16 B Đột biến gen pep4 làm giảm hoạt tính proteinase A carboxypeptidase Y giảm mạnh hoạt tính proteinase B Gen prb1 mã hóa proteinase B Đột biến gen prb1 hoạt tính proteinase B bị ... nucleotide 713-6853 1.3.3.4 Tích hợp gen ngoại lai vào hệ gen P pastoris Cách đơn giản để vector biểu đƣợc tích hợp vào hệ gen P pastoris mở vòng vector biểu enzyme hạn chế vị trí đƣợc thiết kế sẵn gen...
  • 69
  • 527
  • 0

Xem thêm