network model of survival signaling in t cell large granular lymphocyte leukemia

Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

Ngày tải lên : 09/08/2014, 10:23
... found Abundant interstitial infiltrates of T cells were observed in the bone marrow, but without intrasinusoidal localization This case seems to support the hypothesis that T- LGL leukemia may ... important data for a better understanding of RA pathogenesis Competing interests The authors declare that they have no competing interests 12 13 14 15 16 Authors' contributions MP-S conceived of the ... enrolled in this study Written informed consent was obtained from all of the patients, and the study was approved by the local bioethical committee of the Institute of Hematology and Transfusion...
  • 12
  • 565
  • 0
Báo cáo y học: "Developing a realistic sexual network model of chlamydia transmission in Britain" pot

Báo cáo y học: "Developing a realistic sexual network model of chlamydia transmission in Britain" pot

Ngày tải lên : 13/08/2014, 23:20
... 50% in a study setting [26] There are problems in interpreting the estimate of 20% as it is also correlated with the other infection parameter estimates and was fitted to the observed low rate of ... treatment and to recover at a faster rate than those not seeking treatment The recovery rate of those not seeking care is influenced by the level of screening and partner notification After treatment ... rates of partner change than fitting to female data Fitting to data on the number of partnerships generated higher rates of partner change than fitting to the number of individuals observed with...
  • 11
  • 305
  • 0
THE REGULATORY ROLE OF MATRIX METALLOPROTEINASES IN T CELL ACTIVATION

THE REGULATORY ROLE OF MATRIX METALLOPROTEINASES IN T CELL ACTIVATION

Ngày tải lên : 24/08/2014, 11:37
... These enzymes are in an inactive state due to the thiol (SH-) group of the cysteine residue within the pro-domain interacting with the Zn2+ ion in the catalytic domain Disruption of this cysteine-zinc ... receptor Thy1.1 Thymus cell antigen 1, theta Thy1.2 Thymus cell antigen 2, theta TIMP Tissue inhibitor of matrix metalloproteinases TGF-β Transforming Growth Factor beta Th1 T helper xxv Th2 T helper ... complex that consists of TGF-β latent-associated protein, and latent TGF-β-binding protein (30) MMP-2 cleaves the proinflammatory molecule monocyte chemoattractant 12 protein (MCP-3) into a truncated...
  • 202
  • 322
  • 0
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

Ngày tải lên : 13/08/2014, 01:21
... consistent with non-productive latent infection of CCL19-treated infected CD4+ T- cells Treatment of cells with phytohemagluttinin (PHA)/IL-2 or CCL19, prior to infection with WT NL4.3, resulted in ... the synergism obtained by treatment with a combination of prostratin and the HDACi vorinostat in both a cell line and primary cell model of latent HIV infection [46] Herein we also demonstrated ... the induction of virus production with multiple activating stimuli These data are consistent with ex vivo findings from latently infected CD4+ T- cells -3- from patients on combination antiretroviral...
  • 31
  • 268
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Ngày tải lên : 16/02/2014, 09:20
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... Real-time TTCCAGTCCCGGTATATGCT Real-time TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Ngày tải lên : 20/02/2014, 03:20
... determined as the amounts of inorganic phosphorus bAmount of proteins in the BCh-bound membrane fraction was estimated by subtracting the amount in the unbound fraction from that in the total ... contents recovered in raft fractions depend on detergent concentrations We examined the effect of Triton 5457 Two raft subsets in T- cells Fig Protein partitioning under different detergent conditions ... other to maintain the ‘off’ state of T- cell signalling Taken together, the BCh-bound cholesterol-enriched subpopulation contains both activator and inhibitor molecules for TCR signal transduction,...
  • 10
  • 588
  • 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot

Ngày tải lên : 28/03/2014, 22:21
... recent data suggest that both cytokine and TCR signaling may affect regulatory T- cell differentiation, it will be of interest to see the role of the TFKs in regulating the differentiation of this ... associated with increased in ammation and Th1 cytokine production [4] These results suggest that Tec kinases contribute to human diseases involving distinct types of T- cell activation and cytokine ... implicating Tec kinase signaling in multiple levels of regulation of cytokine production Itk and the regulation of cytokineproducing innate T- cell populations The contributions of TFKs to peripheral...
  • 10
  • 312
  • 0
Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

Ngày tải lên : 18/06/2014, 19:20
... progression of T cell infiltration after B cell reconstitution of NOD.Igμ null mice, the animals were spectratyped at different time points At early time points, 9-10 weeks post-B cell reconstitution, the ... predominant clonotype infiltrating the islets of partially diabetes-resistant male NOD mice [24] and, interestingly, is also present in the blood of T1 D patients [25] This may indicate that some ... majority of cells infiltrating the pancreases representing 64 to 74% of total lymphocytic infiltrate Only 13-20% of the cells detected were CD3 + T cells (Figure 1A) Amongst the CD3 + T cell compartment,...
  • 10
  • 447
  • 0
Báo cáo sinh học: " The involvement of survival signaling pathways in rubella-virus induced apoptosis" ppt

Báo cáo sinh học: " The involvement of survival signaling pathways in rubella-virus induced apoptosis" ppt

Ngày tải lên : 18/06/2014, 22:20
... multiple signaling events that control the balance between cell death and cell survival Eukaryotic cells contain a large number of mitogen activated protein kinase (MAPK) signaling cascades that are ... to that of Akt Phosphorylation of BAD, another substrate for Akt, however, could not be detected in RV-infected or mock-infected cells The phosphorylation of c-myc, a transcription factor activated ... infected or infected with RV at an m.o.i of PFU /cell with or without LY294002 (30 µM) or U0126 (15 µM) At indicated time points cell viability was determined by XTT assay Tetrazolium salt (XTT)...
  • 12
  • 357
  • 0
o cáo hóa học:" Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" docx

o cáo hóa học:" Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" docx

Ngày tải lên : 20/06/2014, 04:20
... progression of T cell infiltration after B cell reconstitution of NOD.Igμ null mice, the animals were spectratyped at different time points At early time points, 9-10 weeks post-B cell reconstitution, the ... predominant clonotype infiltrating the islets of partially diabetes-resistant male NOD mice [24] and, interestingly, is also present in the blood of T1 D patients [25] This may indicate that some ... majority of cells infiltrating the pancreases representing 64 to 74% of total lymphocytic infiltrate Only 13-20% of the cells detected were CD3 + T cells (Figure 1A) Amongst the CD3 + T cell compartment,...
  • 10
  • 838
  • 0
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

Ngày tải lên : 09/08/2014, 08:22
... demonstrate a failure of catecholamines to shift T- cell cytokine responses toward the expected Th2 profile in patients with RA; this failure thus generates a cytokine environment that perpetuates inflammation ... apoptosis in T lymphocytes [23], the possible influence of cell death on cytokine production of stimulated T cells upon coincubation with catecholamines was tested After stimulation of T cells for ... Competing interests The authors declare that they have no competing interests Authors' contributions MW was responsible for study design and patient recruitment, carried out intracellular cytokine...
  • 11
  • 363
  • 0
Báo cáo y học: "Maintenance of cytomegalovirus-specific CD4pos T-cell response in rheumatoid arthritis patients receiving anti-tumor necrosis factor treatments" potx

Báo cáo y học: "Maintenance of cytomegalovirus-specific CD4pos T-cell response in rheumatoid arthritis patients receiving anti-tumor necrosis factor treatments" potx

Ngày tải lên : 12/08/2014, 14:22
... patients [30] Therefore, the outcome of the anti-CMV CD4pos T- cell response in RA patients treated with anti-TNF-α is of interest Case reports have mentioned the reactivation of CMV in anti-TNF-treated ... [21], we tested the intracellular production of IFN-γ in CD4pos T cells in response to total CMV Ags in patients with RA, before and after initiation of treatment with an anti-TNFα agent Specific ... reports [8,13] suggest that in vitro responses to viral proteins or peptides are of help to identify risks of viral infection in patients treated with anti-TNF In addition, the conservation of anti-CMV...
  • 8
  • 231
  • 0
Báo cáo y học: "Discovery of a new human T-cell lymphotropic virus (HTLV-3) in Central Africa" potx

Báo cáo y học: "Discovery of a new human T-cell lymphotropic virus (HTLV-3) in Central Africa" potx

Ngày tải lên : 13/08/2014, 09:21
... throughout the African continent HTLV-3 infection seems to be reflected by an HTLV indeterminate serological WB pattern This raises an important public health question regarding the effectiveness of the ... living in a remote settlement in the ocean department of Southern Cameroon His plasma was reactive on MT2 cells (titer: 1/320) but was negative on C19 cells The HTLV BLOT 2.4 WB [11] exhibited ... strong reactivity to p19 and a faint one to MTA-1 (Figure 2A) On the INNOLIA strip (Innogenetics, Ghent, Belgium) [12], it reacted faintly (+/-) with the generic p19 (I/II), but strongly to the...
  • 4
  • 295
  • 0
Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions

Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions

Ngày tải lên : 10/09/2015, 09:29
... JAK-STAT signaling is often somatically mutated and inactivated in cHL (Joos et al., 2000; Mottok et al., 2007; Weniger et al., 2006) Besides genetic mutation, constitutive activation of JAK-STAT ... (Perussia et al., 1987) In addition, LT activity is also detected in osteolysis reaction Osteolysis or osteoclast activation is initiated by LT stimulation LT stimulated osteoblastic cells to release ... implicated by the presence of the phosphorylated form of AKT in HRS cells Inhibition of AKT causes death of HRS cell lines further supports its role in regulating the survival and pathogenesis of the...
  • 204
  • 400
  • 0
The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization

The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization

Ngày tải lên : 14/09/2015, 08:27
... define the Th1/Th2 differentiation mainly by modulating the interplay of three fundamental groups of ligandreceptor interaction at cell surface They are: (1) nature of interaction of the TCR with ... Recognition by the innate arm of the immune system leads to the release of cytokines, resulting in a state of inflammation For most infections, the innate immune system is sufficient to clear the infection; ... present, tend to differentiate into Th2 cells This is because IL-4 and IL-6 promote the differentiation of Th2 cells IL-4 is the most dominant factor in determining the Th2 polarization in cultured...
  • 250
  • 384
  • 0
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice 2

Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice 2

Ngày tải lên : 14/09/2015, 09:08
... function as high-affinity binding sites for capturing antigens at limiting concentrations In addition, Ig receptor-mediated endocytosis leads to an intracellular pathway of protein traffic that ... containing light and heavy chains marks the transition to the immature stage It is at the immature stage that the BCR is first able to interact with conventional polymorphic ligands In contrast to ... 5’ GTT CTC ATA GAG ATG CTC CG 3’ 5’ TCA AAG ACG ACG GCA TCC TCT ACC 3’ 5’ GTT CTC ATA GAG ATG CTC CG 3’ 5’ GCG GTG CAT GCC TTT AAT CTC A 3’ 5’ GAG GAG ATG GGG TGA GGA TT 3’ 5’ CAC ATC CTC CTG...
  • 132
  • 329
  • 0
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice

Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice

Ngày tải lên : 14/09/2015, 10:44
... domain binding protein Geneticin Gancyclovir Growth factor receptor-bound protein Haemagglutinin 1,3,4,5-tetrakisphosphates Immunoglobulin Interleukin Inositol 3,4,5-triphosphate Insulin receptor ... Downstream of tyrosine kinases Extracellular-signal-regulated kinase Embryonic stem Florescence activated cell sorting Fluorescein isothiocyanate Interleukin Four Receptor Interacting Protein RasGAP ... novel tyrosine kinase Mitogen activated protein kinase Mitogen activated protein kinase kinase Mitogen activated protein kinase kinase kinase Major histocompatibility complex Macrophage colony-stimulating...
  • 16
  • 229
  • 0
A survival model of local gentry in late qing and early republic of china

A survival model of local gentry in late qing and early republic of china

Ngày tải lên : 04/10/2015, 10:23
... 日文书目 405 v Abstract This thesis attempts to provide and interpret a survival model of a group of lower class intellectuals, living in the southeastern part of China during the late Qing and early ... period These men stayed away from the national political centre, but did not detached totally from the state system Taking a perspective of both intellectual and local history, the specific case study ... (1850-1918): A SURVIVAL MODEL OF LOCAL GENTRY IN LATE QING AND EARLY REPUBLIC OF CHINA 周静秋 ZHOU JINGQIU 新加坡国立大学中文系 硕士学位论文 A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ARTS DEPARTMENT OF CHINESE STUDIES...
  • 416
  • 1.9K
  • 0
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis

Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis

Ngày tải lên : 02/11/2012, 11:17
... infection might alter the cIAPs gene expressing of liver cell, finally instigating the carcinogenesis of the cells it infected This is agreement with the observation that the patients infected by HBV ... associating with the development of HCC [6, 13, 14, 37, 17] However, the mechanism of how these proteins contribute to the carcinogenesis is still in the investigation The involvement of these proteins ... dormant until the initiator caspases activate them by proteolysis [8] The activated executioner caspases cleave a number of structural and regulatory proteins, leading to apoptotic cell death [26]...
  • 6
  • 514
  • 0