name icon or tooltip for a graph in the graph gallery

Tài liệu Trading For A Living In The Forex Market_2004(pdf) pdf

Tài liệu Trading For A Living In The Forex Market_2004(pdf) pdf

Ngày tải lên : 10/12/2013, 10:15
... forward spread The spot rate is the main building block The forward spread is also known as the forward points or the forward pips The forward spread is necessary for adjusting the spot rate for specific ... important landmark in the history of financial markets in the XX century lead to the formation of Forex in the contemporary understanding That is the currency may be traded by anybody and its value ... contract on the spot market a bank serving a trader tells the latter the quota – an evaluation of the currency traded against the U.S dollar or another currency A quota All training material found...
  • 75
  • 650
  • 4
History of Cuba; or, Notes of a Traveller in the Tropics pdf

History of Cuba; or, Notes of a Traveller in the Tropics pdf

Ngày tải lên : 24/03/2014, 03:21
... into nine provinces, namely, Baracoa, Bayaguitizi, Macaca, Bayamo, CHAPTER I 22 Camaguey, Jagua, Cueyba, Habana and Haniguanica At the head of each was a governor, or king, of whose laws we have ... the great admiral, has been known to Europe since 1492, and has borne, successively, the names of Juana,[1] Fernandina, Santiago and Ave Maria, having found refuge at last in the aboriginal appellation ... of Havana, Niepe and Nuevitas, are among the best The bay of Matanzas is also capacious; Cardenas and the roadstead of Sagua la Grande have plenty of water for brigs and schooners Matanzas,[17]...
  • 109
  • 354
  • 0
PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition

PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition

Ngày tải lên : 24/12/2013, 23:11
... tài: “State-owned enterprises (SOEs) in Vietnam Perceptions strategic direction for a society in transition” Tạm dịch: Nhóm - Lớp Đêm - K22 Tiểu luận môn PPNCKH GVHD: TS Đinh Thái Hoàng date]TiTi6 ... lãnh đạo vấn, ý định cấu lại doanh nghiệp họ kinh tế cạnh tranh toàn cầu kinh tế Việt Nam ch a hoàn toàn mở c a để doanh nghiệp cạnh tranh cách tự do, bình đảng Thứ hai, tác giả tiếp tục phân tích ... ngh a Trong khuôn khổ môn học Phương pháp nghiên cứu khoa học, nhóm phân công phân tích báo cáo nghiên cứu có đề tài "State-owned enterprises (SOEs) in Vietnam - Strategic direction for a society...
  • 18
  • 676
  • 2
Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt

Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt

Ngày tải lên : 13/02/2014, 07:20
... of “make shift measures” to urinate • Dehydration (not drinking fluids to prevent urination) Vaginal symptoms: Itching, burning, pain, & discharge Menstrual complaints: Pain, heavy bleeding, ... Implications for Nursing • • • Findings can be incorporated into routine predeployment care for female Soldiers to promote well p y p being and health Preventive measures can be implemented to avoid ... Research Question Q • Does providing women with information on feminine • hygiene and menstrual self-care practices lead to a decrease in genitourinary complaints during deployment? Specific Aims...
  • 18
  • 734
  • 0
Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx

Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx

Ngày tải lên : 05/03/2014, 16:20
... for using the safe water as an indicator; Comparable: the indicators should facilitate the assessment between different circumstances and time-scales One indicator that has, on the onehand, a ... locations, the primary reason for an inability to escape poverty has to with the natural environment For example, assessments of the poor living in dryland areas may conclude that the main reasons ... problems and are useful for policy-formulation and decision-making, allowing agents to make informed decisions, what facilitates the implementation of policygoals For instance, indicators on percentage...
  • 9
  • 352
  • 0
A study in the growth mechanism of silicon nanowires with or without metal catalyst

A study in the growth mechanism of silicon nanowires with or without metal catalyst

Ngày tải lên : 16/03/2014, 15:09
... Metal-assisted growth of SiNWs A basic aspect of the VLS mechanism is the metal particle acting as a catalyst for the anisotropic growth of SiNW with a crystalline structure A catalyst particle ... provides a site for absorption of vaporphase silicon atoms The continuous absorption induces the supersat- uration of the formed liquid alloy with silicon atoms, which leads to nucleation and growth ... delicate catalyst positioning The metal catalyst can be generated by thermal evaporation, sputtering, or electrochemical methods The particle size can be modified by varying the reaction parameters...
  • 5
  • 576
  • 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Ngày tải lên : 17/03/2014, 23:20
... kit (Stratagene) PCR amplification was performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified ... eliminate materials in the extracts that bind nonspecifically to the beads After removing the beads by filtration, 200 lg of the nuclear extract proteins were incubated in reaction buffer containing ... (SM) are indicated at the left of each panel The purified protein bands are indicated by solid arrowheads Fig Microsequencing analysis of the MREa-binding proteins (A) The N-terminal sequence of the...
  • 11
  • 628
  • 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Ngày tải lên : 23/03/2014, 13:20
... Monitoring and status information about the team, as reported by you to the higher management • General information about the organization and external information to the organization • Cultural influences ... in his career and honed his skills in Bangalore, India, and then in Silicon Valley, USA working for Oracle Corporation He now works as Director of Engineering at Intuit India Rahul finds management ... of the team on various issues The information processing roles are increasingly becoming more important as the amount of information and the mode of information have changed and has been changing...
  • 328
  • 4.5K
  • 0
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

Ngày tải lên : 23/03/2014, 17:21
... to rat Na+/K+-ATPase isoforms and actual ouabain or OLF concentrations The figure summarizes the huge variation in ouabain a nities of Na+/K+-ATPase depending on species and a- isoforms, actual ... of ouabain applied and (c) assume a similar role by putative endogenous ouabain or OLF Ouabain-sensitive and -insensitive a- isoforms of Na+/K+-ATPase in rats All isoforms of the catalytic a- peptide ... which the latter may have a sublocalization critical for the observations looking at ouabain as a signal-transducer Experiments pointing to a pivotal role of ouabain in signal-transduction In the...
  • 4
  • 423
  • 0
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx

Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx

Ngày tải lên : 23/03/2014, 18:20
... into account in this paper, the feedback corpus contains further useful information For example, we can obtain training data consisting of instances of errors by comparing the feedback corpus ... in training data For simplicity of implementation, they are excluded from training data Note that the tagging rules can be used only for generating training data They cannot be used to distinguish ... chicken/mass for dinner where (4) ¢ £¡ (2) Now rules that match the template can be obtained from the training data All we need to is to collect words in from the training data Here, the words in Table...
  • 8
  • 502
  • 0
notes for a course in game theory - maxwell b. stinchcombe

notes for a course in game theory - maxwell b. stinchcombe

Ngày tải lên : 08/04/2014, 12:17
... probability spaces are also called random variables If a random variable f takes its values in R or RN , then the class of sets B will always include the intervals (a, b], a < b In the same vein, ... optimal plan A caveat: a (s) is not defined for for any s’s having margS (p)(s) = By convention, an optimal plan can take any value in A for such s Notation: we will treat the point-to-set mapping ... arguments for i playing µi involve i acting as if they are solving the problem maxai ∈Ai ui (µ\ai), that is, acting as if they know that everyone else is playing their part of the vector µ, and that they...
  • 169
  • 414
  • 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Ngày tải lên : 18/06/2014, 19:20
... of the Qatari population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E.,...
  • 8
  • 375
  • 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

Ngày tải lên : 20/06/2014, 01:20
... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622, using...
  • 4
  • 451
  • 0
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc

báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc

Ngày tải lên : 20/06/2014, 03:20
... of the Qatari population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E.,...
  • 8
  • 494
  • 0
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

Ngày tải lên : 20/06/2014, 22:20
... subsystem, the error correction system’s inputs may be incorrect Since the data are correct under the single failed subsystem assumption, the data contain no errors and the error Hamidi et al EURASIP ... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in the ... linear sequential circuit with input memory order m; that is, inputs remain in the encoder for an additional m time units after entering Typically, n and k are small integers, k < n, the information...
  • 12
  • 574
  • 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot

Ngày tải lên : 21/06/2014, 04:20
... with the CARD program strategic framework So far a survey has been conducted to collect the base line information on the economic status of farmers participating in traditional VAC farming systems ... i) has been completed with the revised performance measures As outlined in the log frame, the performance measures are the collection of improved VAC materials available regionally and internationally; ... and animal husbandry practices) and identify incentives and constraints for improved VAC application ii) To develop appropriate improved VAC guidelines and manuals for household aquaculture in...
  • 7
  • 351
  • 1
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx

Ngày tải lên : 21/06/2014, 04:20
... VAC guidelines and manuals for household aquaculture in the North Central of Vietnam iii) To build capacity for improved VAC application among stakeholders involving in aquaculture product market ... traditional integrated farming systems (VAC) - a new livelihood option for poor farmers in the coastal communities Vietnamese Institution Centre for Environment and Disease Monitoring in Aquaculture ... existing faming practices As outlined in the log frame, the performance measures are the collection of improved VAC materials available regionally and internationally; construction of questionnaire...
  • 8
  • 416
  • 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx

Ngày tải lên : 21/06/2014, 04:20
... Snake-head in tanks and cages Snake-head in tanks and cages Proposal of Improved VAC for Farmers in Thanh Hoa Earthworm + Snake head in tanks Earthworm + Snake head in tanks Earthworm + Snake ... Photographs of discussion during the inception workshop in Hue Training workshop in Quang tri This workshop was for participants among project provinces including; Thanh Hoa, Nghe An, Ha Tinh, Quang ... 92664422 Email: r.fotedar@curtin.edu.au In Australia: Administrative contact As mentioned above Name: Position: Organisation Telephone: Fax: Email: In Vietnam Mr Vo Van Binh Name: Head of environment...
  • 13
  • 343
  • 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt

Ngày tải lên : 21/06/2014, 04:20
... Water parameters were within acceptable ranges for fish health and growth Examination of dead fish suggested that the mass mortality of eels one week after stocking was a result of transportation ... particularly in areas of limited access to water, • Availability of raw materials (eg manures from cattle and /or poultry in the area), • Suitable for culture of fresh and brackish water species ... container 14 Containers should be in a suitable and convenient location that is, close to manure, away from strong and direct sunlight and in an area not prone to flooding The container floor plays...
  • 15
  • 412
  • 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt

Ngày tải lên : 21/06/2014, 04:20
... environmentally sustainable aquaculture , background information and data was collected in the provinces of; Thanh Hoa, Nghe An, Ha Tinh, Quang Binh and Quang Tri From the information gained through ... markets and skills available were also considered An example of such a situation is a farm in Ha Tinh where the water surface area was greater than three hectares and instead of intensification, a ... project farmers and many interested farmers in six project provinces have had the chance to visit other farms and learn more for their farm modification; v) Organizing the visit for of CEDMA’s staff...
  • 9
  • 480
  • 0