name and describe the eight parts of a business letter
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... Peplow, F. Yamakura and T. Matsumoto for the
analyses of iron and manganese in protein samples. We also wish to
thank H. Steinman for the gift of E. coli OX32 6A. We finally thank Mr
M. Farrugia for ... incubated at 50 °Cfortheindicated
times. Aliquots were removed for analysis of SOD activity and were
calculated to give 1 unit of SOD activity in the standard SOD assay
conditions used and all values ... program
CE [35] while mutational analyses were carried out using
the CARA and ENCAD algorithms included in the
GENEMINE
program.
Bacterial strains and vectors
The mutagenesis and expression phagemid,...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... 5–8). The
pK
a
of Asp140 is much lower than that of Asp142 and
Glu144 in all situations where all three residues are present
and the one proton shared by Asp140 and Asp142 appears
to remain on Asp142 ... glycosyl-
transferase elucidate catalysis in the alpha-amylase family. Nat.
Struct. Biol. 6, 432–436.
16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai,
A. , Henrissat, B. & Dijkstra, ... However, the mechanistic roles of several of
these residues are not described well and there is no example
of mutational analysis of all of these residues in the same
enzyme.
To obtain an insight...
- 10
- 651
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... the reaction mechanism
of a bacterial ATP-citrate lyase
Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka
Department of Synthetic Chemistry and Biological Chemistry, Graduate ... products,
AclA (a subunit) and AclB (b subunit). By comparing the
primary structures of AclA and AclB with that of the
mammalian enzyme, we found that AclA and AclB
Correspondence to T. Imanaka, Department ... lanes 2 and 5, and AclB subunits (b) in lanes 3 and 6.
Molecular masses (kDa) are indicated on the side of each panel. The
asterisk indicates the degradation product of AclA described in the
text.
Fig....
- 8
- 551
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... B=MIC
B
ị=n
where A and B are the MICs of drug A and drug B in the
combination, MIC
A
and MIC
B
are the MICs of drug A
and drug B alone, FIC
A
and FIC
B
are the FICs of drug A
and drug B and n is the number of ... purchased from Avanti Polar Lipids (Alabaster,
AL, USA). FITC-Ds were purchased from Sigma. All other
chemicals were reagent grade. For antimicrobial assays,
the commercially available quality ... pleurocidin
derivatives and buforin 2, do not disturb the
membrane of E. coli at their minimal antimicrobial
concentrations, but rather traverse it, accumulate
intracellularly, and damage a variety of essential...
- 18
- 494
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
Ngày tải lên :
16/03/2014, 05:20
... Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V,
Jasmani S, Okuno A, Ohira T, Okumura T, Aida K &
Wilder MN (2004) Molecular characterization of a
cDNA encoding vitellogenin in the coonstriped ... dsRNA,
DNA corresponding to the mature peptide of MeMIH-B
was amplied by PCR using T7 promoter-linked primers
(forward, 5Â-TAATACGACTCACTATAGGTACTATG
TATCGCATGCCAAT-3Â; reverse, 5Â-TAATACGACTC
ACTATAGGTACTTTAAAGTCCCGGGTTGA-3Â). ... nmol or 0.66 nmol of rMIH-B at the arthropodial
membrane of the periopod and returned to the culture
tanks. At 24, 48 and 72 h after injection, the hepatopan-
creas and ovary of the shrimp were...
- 11
- 546
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... DosH as a template
and using the following respective 5Â-sense primers: 5Â-gatga
gtcgggagACCcagctggagaaaaaag-3Â,5Â-gatgagtcgggagTTTcag
ctggagaaaaaag-3Â,5Â-ggacccgttttgcgACCtcgaaagtgagc-3Â,
and ... decreased the rate of auto-oxidation [5],
whereas Ala and Asn substitutions at Asp40, an
amino-acid residue that interacts via two water mole-
cules with the proximal ligand His77, markedly
increased ... mutations,
although the effects of the Leu99 and Leu115 muta-
tions were modest compared with those of Met95
mutations.
It seems likely that potential data based on our data
and that of others have accuracies of...
- 14
- 390
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
Ngày tải lên :
17/03/2014, 10:20
... dysfunction.
ACKNOWLEDGEMENTS
We thank Drs Carlos E. Argaran
˜
a and Mario Guido for critical
reading of the manuscript, Mrs S. N. Deza and Mrs M. G. Schachner
for technical assistance and Dr Stephen Anderson for ... incorporation of
the radioactive analogue. Similarly, when tubulin was first
blocked with nonradioactive nitrotyrosine and then incu-
batedwithradioactivetyrosine,noradioactivitywas
incorporated (data ... days. The antisera were usually collected 15 days after
each injection and tested for affinity and specificity and
stored at )20 °C. Mouse monoclonal antibodies against
Tyr-tubulin (Tub 1A2 ) and total...
- 9
- 518
- 0
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
Ngày tải lên :
17/03/2014, 23:20
... that the PAS domain of the
phosphorelay histidine kinase A of Bacillus subtilis was
recently shown to be a catalytic ATP-binding domain [31].
As the PAS domain of BvgS contains a putative ATP
binding ... energy of a cell, and it was
recently shown that they can bind small ligands such as
FAD and ATP [13,29,31]. In fact, mutations in this domain
have been reported which cause either the inactivation ... the addition of Q-0 and/ or
ATP samples were taken immediately and after 0.5, 1, 2, 4,
8, 16 and 32 min; the reaction was stopped by the addition
of sample buffer. The half-life of phosphorylated...
- 6
- 421
- 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
Ngày tải lên :
23/03/2014, 04:20
... centric approach to business
and accounting. And in the United States, the internationalization of accounting
standards may lead to a change in the language of accounting.
The growth of outsourcing ... volatility.
Our research identified globalization
1
as a significant and growing trend impacting
internal audit today and in the future. As organizations expand to take advantage
of global markets and supply ... trends appear to be closely
related: increased globalization and advances in technology will have a direct
impact on talent, and there are notable ties between what participants had to say
about...
- 68
- 456
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC
JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC
JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC
JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC
VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC
VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC
VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC
VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC
VL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA
JH1-2.link...
- 11
- 679
- 0
Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx
Ngày tải lên :
30/03/2014, 16:20
... denaturing effects
of urea
Arnab Mukherjee, Manas K. Santra, Tushar K. Beuria and Dulal Panda
School of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai, India
Organisms, including ... is
entropically unfavorable and it becomes more unfavo-
rable with increasing surface area of the protein.
Osmolytes may decrease the solvent-accessible surface
area of proteins and the reduction in the ... 6). Taken together, these results indicated that
TMAO increased the light-scattering signal of the
assembly reaction and sedimentable polymer mass by
enhancing the formation of larger bundles of...
- 13
- 599
- 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
Ngày tải lên :
31/03/2014, 07:20
... 5Â-AACCATGGCTAAAGCAGATTGTAATGG
TGCATGT-3Â; the 4-kDa peptide C-terminal primer:
5Â-AAGAATTCTTATTATCCAGTTGGATGTATGCA
GAA-3Â. The amplied sequence was cloned into the
plasmid pKF18 via the EcoRI and SalI ... residues at the A- chain N-terminus
(GlyA1–IleA2–Val1 3A) [24,25], the A- chain C-terminus
(TyrA19 and AsnA21) [26], the B-chain central helix
(ValB12 and TyrB16) [27], and the B-chain C-terminal
b strand ... DNAs as
templates and the synthetic primers legF1 (5Â-AGC
AGCAGATTGTAATGGTG-3Â)andlegR1(5Â-CAGC
ACTTCAGAATCAGAGTC-3Â). PCR products were
cloned on pT7Blue T-vector (Novagen, Darmstadt) and
their...
- 8
- 386
- 0
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
Ngày tải lên :
02/06/2014, 15:10
...
methods also help the suppliers be active
choosing what particular customers for
advertisement objects .
What are the good and bad points of
What are the good and bad points of
advertising ... customers
usually receive the leaflets
after that they throw away
or if they read it but they
can’t remember information
of the suppliers
Advertising has both good and bad points. Therefore, ... 1102015087
MAI CHAU DAN THANH 1102015096
BUI THI HOANG ANH 1102015001
TOPIC 13
By what means can a product or a
servicebe advertised?
Briefly present the strengths and
weaknesses of each means
A product...
- 20
- 862
- 0
