n fakotakis and g kokkinakis

Tài liệu Từ điển chứng khoán Chủ đề G ppt

Tài liệu Từ điển chứng khoán Chủ đề G ppt

Ngày tải lên : 21/01/2014, 10:20
... ng n hàng đang t n tại. Mỗi ng n hàng trong nhóm có Hội đồng Qu n Trị riêng, công ty chủ qu n li n kết các hoạt động của tất cả các ng n hàng trong nhóm và n m đa số chứng kho n v n trong các ... giá ngưng do khách hàng định) có giá trị đ n cuối tháng. Trong trường hợp giá giới h n, khách hàng chỉ thị cho broker hoặc là mua với giá giới h n hoặc giá cao h n. Trong trường hợp giá ngưng, ... đề G GOOD MONEY: Ti n có giá trị n i tại cao Ng n quỹ: quỹ li n bang, có giá trị thanh lý cùng ngày ngược lại với quỹ thanh lý nhà. Quỹ n y được hiểu ngầm theo hai cách: 1. Quỹ đòi hỏi 3 ngày...
  • 2
  • 234
  • 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Ngày tải lên : 18/02/2014, 00:20
... both immigrants and U.S born workers. However, the gender gap is slightly lower among immigrants than among U.S born women. Twenty-nine percent of foreign- born business owner are women, as are ... sense of immigrant- owned businesses. This has never been a very satisfying proxy—many immigrants are not Hispanic or Asian, and many Hispanics and Asians are not immigrants and is even less so ... Asian Share of foreign- born Asian Foreign- born total Share of foreign- born total Agriculture, forestry, fishing, and hunting 2,273 1% n/ a n/ a 3,031 1% 1,585 1% 6,938 1% Mining n/ a n/ a n/ a...
  • 37
  • 436
  • 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

Ngày tải lên : 19/02/2014, 12:20
... of many molecular changes that accompany malignant transformation [1]. Perhaps the best known glycosylation change inducing malignancy is enhanced b1,6GlcNAc branching of N- glycans, leading to ... sLe a antigen expression and secretion. Moreover, only cell lines expressing b3Gal-T5 express the antigen, and cells not expressing are forced to do by cDNA transfection.Onthe other hand, sLe a synthesis ... Trinchera, M. (2001) b1,3- Galactosyltransferase b3Gal-T5 acts on the GlcNAcb1-3Galb1- 4GlcNAcb1-R. sugar chains of carcinoembryonic antigen and other N- linked glycoproteins and is down-regulated...
  • 9
  • 460
  • 0
Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf

Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf

Ngày tải lên : 19/02/2014, 16:20
... other binding elements may contribute to the modu- lation of egr-1 gene expression (Fig. 4B). Effects of n- 3 and n- 6 PUFAs on the synthesis of caveolin-1 and caveolin-3 and on the location of p42/44 ... their preparation, and how long they are exposed to this cytokine. C onsequently, IL-1b has been considered to be a mitogen and effective co-mitogen acting in conjunction with other growth factors ... for E gr-1 were 5¢-CAGCAGTCCC ATTTACTCAG-3¢ (forward) and 5¢-GACTGGTAGCTG GTATTG-3¢ (reverse) [23]. PCR was performed in a Hybaid Omnigene thermocycler under the following con- ditions: d enaturation...
  • 12
  • 499
  • 0
Tài liệu Báo cáo khoa học: "Skip N-grams and Ranking Functions for Predicting Script Events" doc

Tài liệu Báo cáo khoa học: "Skip N-grams and Ranking Functions for Predicting Script Events" doc

Ngày tải lên : 22/02/2014, 02:20
... language modeling and skip-gram modeling. In skip-gram modeling, skips in the n- grams are only used to increase the size of the training data; prediction is performed exactly as in classic language ... by (1) filtering out non-narrative articles, (2) applying a dependency parser, (3) applying a coreference resolution sys- tem and (4) identifying event chains via entities and dependencies. First, ... de- fine the function f for ranking events. We consider three such ranking functions: • Chambers & Jurafsky PMI . Chambers and Jurafsky (2008) define their event ranking function based on pointwise...
  • 9
  • 527
  • 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

Ngày tải lên : 07/03/2014, 11:20
... of the windows, sparkling among close-growing trees; and I had not finished my second[10] cigarette, when a carriage drove round the corner and stopped. I moved into the background. A groom jumped ... Carmona. They spoke only a few words. Then the Duke opened the door, and the two ladies went out, Monica not once looking up. No soonerhad theygone thanCarmona walkedto thewindow, and seeing me in ... Lady Vale-Avon and her daughter live not far from the Princess, in the Isle of Wight. When the King came a-courting to England, came also, though not exactly in his train, another Spaniard, the...
  • 424
  • 1.3K
  • 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Ngày tải lên : 07/03/2014, 11:20
... M2-goa1-s, 5¢- CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TT CTGCAGTTAATACAA GCCGCATCCACGAAGA-3¢. (An engineered PstI recognition site is single-underlined. The ... oxotremorine, is effective on GAR-3, but not on GAR-1 and -2) [39], suggesting that the manipulation of GOA-1 signalling by M 2 using muscarinic agents may be accompanied by affecting GAR-3 in C. elegans. ... M 2 transgenic worms in a gar-3 mutant background. In conclusion, M 2 is a good candidate for the manipulation of GOA-1 signalling in C. elegans under carefully controlled conditions. Experimental...
  • 9
  • 400
  • 0
Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt

Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt

Ngày tải lên : 07/03/2014, 22:20
... capture richer contexts and long-distance dependencies. In particular, we integrate backward n- grams and mu- tual information (MI) triggers into language models in SMT. In conventional n- gram language models, ... language mod- els in machine translation. In Proceedings of the 2007 Joint Conference on Empirical Methods in Nat- ural Language Processing and Computational Natu- ral Language Learning (EMNLP-CoNLL), ... machine translation. In Proceedings of the International Conference on Agents and Artificial Intelligence, pages 61–68, Porto, Portugal, January. Roni Rosenfeld, Jaime Carbonell, and Alexander...
  • 10
  • 415
  • 0
Green Functors and G-sets~ pdf

Green Functors and G-sets~ pdf

Ngày tải lên : 14/03/2014, 21:20
... i'~ the injection from G/ G~, into Z associated to s'. If s' = (K, xs), then G~ , = K N ~G~ and ai~,(gG~, ) = a(gs') = a((gK, gxs)) = gxs = i~(gxG~ ) = i~xp~c ~G~ (gG~, ) 9 ... possible generalizations of the notion of centre of a ring, one in terms of commutants, the other in terms of natural transformations of functors. The first one gives a decomposition of any Green ... Springer-Verlag. Violations are liable for prosecution under the German Copyright Law. 9 Springer-Verlag Berlin Heidelberg 1997 Printed in Germany The use of general descriptive names, registered...
  • 342
  • 354
  • 0
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf

Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf

Ngày tải lên : 17/03/2014, 10:20
... 5¢- CTGGGGCCCGGGTTCTGGATCCGTTCGCGGCGGCTCTGGAACAGATTCTGGAA-3¢ pr24/25AA 5¢- CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGAACAGAGCCGCGAAAGCTCC-3¢ pr26/27AA 5¢- CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGGCCGCATTCTGGAAAGCTCC-3¢ pr2–36sense ... 5¢- CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGGCCGCATTCTGGAAAGCTCC-3¢ pr2–36sense 5¢- AATTGGGGATCCGAGAAGTGCAGTTAGGGCTGGGAAGG-3¢ pr2–36antisense 5¢- GATCGAATTCGTTCTGGATCACTTCGCGCACGCTC-3¢ pr1–14sense 5¢- GATCGAAGTGCAGTTAGGGCTGGGAAGGGTCTACCCTCGGCCGG-3¢ pr1–14antisense ... 5¢- GATCCAGAATCTGTTCCAGAGCGTGCGCGAAGTGATCCAGAACCCGGGCCCCG-3¢ pr24–39antisense 5¢- AATTCGGGGCCCGGGTTCTGGATCACTTCGCGCACGCTCTGGAACAGATTCTG-3¢ pr172B 5¢- CGGAGCAGCTGCTTAAGCCGGGG-3¢ pr-242 5¢- AAGCTTCTGCAGGTCGACTCTAGG-3¢ PDsense...
  • 12
  • 597
  • 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Ngày tải lên : 23/03/2014, 07:20
... 5¢-ATGGTGAGCAAGGGCGAG-3¢ (forward) and 5¢-AGCAGCAGCAGCCTTCTTAG-3¢ (reverse). pUGWB5-PCaP1 G2 A -GFP and pUGWB5- PCaP1 1)27 ⁄ G2 A -GFP were generated from pUGWB5- PCaP1-GFP and pUGWB5-PCaP1 1)27 -GFP, ... preparations. Protein quantification, SDS-PAGE and immunoblotting The protein concentration was determined using a bicinch- oninic acid protein assay reagent kit (Pierce Biotechnology, Rockford, ... the site of binding to PtdInsPs In general, the polybasic residue region is a good can- didate for binding to PtdInsPs. The N- terminal part is the most basic region, containing seven Lys residues. Thus,...
  • 16
  • 424
  • 0
Báo cáo khoa học: Characterization of surface n -alkanes and fatty acids of the epiphytic lichen Xanthoria parietina, its photobiont a green alga Trebouxia sp., and its mycobiont, from the Jerusalem hills pot

Báo cáo khoa học: Characterization of surface n -alkanes and fatty acids of the epiphytic lichen Xanthoria parietina, its photobiont a green alga Trebouxia sp., and its mycobiont, from the Jerusalem hills pot

Ngày tải lên : 23/03/2014, 17:21
... n- alkanes ranging in concentration from 187 to 211 mgÆ (g dry wt) )1 ; n- alkane concentrations in the photobiont and mycobiont were 17–24 and 215–262 mgÆ (g dry wt) )1 , respectively. Keywords: alkanes; ... micro-organism: a fungus (termed the mycobiont) and a green alga or a cyanobacte- rium (termed the photobiont). These organisms have both algal and fungal properties [1,2] and produce n- alkane, unusual ... widespread in many lichens, including Xanthoria aureola [57], and more than 10 algal species belonging to this genus have been isolated from lichens; however, their hydrocarbons and fatty acids have not...
  • 6
  • 613
  • 0
Báo cáo khoa học: Effect of monovalent cations and G-quadruplex structures on the outcome of intramolecular homologous recombination doc

Báo cáo khoa học: Effect of monovalent cations and G-quadruplex structures on the outcome of intramolecular homologous recombination doc

Ngày tải lên : 29/03/2014, 23:20
... rearrangements and pro- mote RecA-independent homologous recombination [31]. Genome-wide predictions have shown an abun- dance of G- quadruplex DNA motifs in the genomes of Homo sapiens [32] and ... the DNA fragment that contains the original MsH43 sequence, and asterisks mark the DNA fragment containing altera- tions in the size of MsH43 (unequal recomb- inants). (B) Analysis in 1.5% agarose ... [2,3]. This protein promotes the key homologous pairing and strand-exchange reactions leading to the formation of interlinked recombination intermediates [4]. Changes in ionic strength alter the...
  • 11
  • 472
  • 0
Báo cáo khoa học: Characterization of a b-N-acetylhexosaminidase and a b-N-acetylglucosaminidase/b-glucosidase from Cellulomonas fimi potx

Báo cáo khoa học: Characterization of a b-N-acetylhexosaminidase and a b-N-acetylglucosaminidase/b-glucosidase from Cellulomonas fimi potx

Ngày tải lên : 30/03/2014, 10:20
... g L )1 ) containing 50 mgÆL )1 kanamycin. Screening and isolation of Cellulomonas fimi genes encoding N- acetylglucosaminidases Plasmid isolations, restriction enzyme digests, ligations and transformations ... Excellence of Canada, the Natural Sciences and Engineering Research Council of Canada, the Swiss National Science Foundation, the Deutsche Forschungsgemeinschaft and Neose Technol- ogies. We thank ... NotI and XhoI introduced by the primer): CF2NdeI 5¢-CC CAT ATG CCC GAC GTC GCC GTC ATC C-3¢; CF2NotI 5¢-TT GCG GCC GCG CCC GGC GCG GAA CCC-3¢; CF5NdeI 5¢-AA CAT ATG ATC GAC CTG ACC GCA GCC-3¢;...
  • 13
  • 449
  • 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

Ngày tải lên : 20/06/2014, 01:20
... down-regulation, antigen loss, sterical hindrance of antigen recognition, conformational change or that in vivo G- CSF treatment leads to a reduction of CD46 expression on the cell membrane. Seya ... complement regulator and pathogen receptor that mediates links between innate and acquired immune function. Tissue Antigens 2004, 64:111-118. 13. Greenstone HL, Santoro F, Lusso P, Berger EA: Human ... Berlin, Germany Email: Stefanie Thulke* - stefanie.thulke@charite.de; Aleksandar Radonić - aleksandar.radonic@charite.de; Andreas Nitsche - NitscheA@rki.de; Wolfgang Siegert - wolfgang.siegert@t-online.de *...
  • 4
  • 272
  • 0