n 9823 in a national sample survey of hypertension in vietnam

Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot

... physiotherapists These results indicates that there is a discrepancy in treatment of patients depending on which weekday they are operated on in Sweden By comparison, in Australia and New Zealand during ... important questions may have been overlooked and the exact description of the actual clinical practice, in observational studies, is warranted in the future An intrinsic selection bias in questionnaire ... of care time, and increased care load The main purpose of physiotherapy following cardiac surgery was seen as preventing and treating postoperative complications, improving pulmonary function...

7
437
0

báo cáo khoa học: " Which factors explain variation in intention to disclose a diagnosis of dementia? A theory-based survey of mental health professionals" pot

Danh mục: Báo cáo khoa học

... explained over 40% of variation in intention Interventions around clarifying and revising team roles may offer promising means of http://www.implementationscience.com/content/2/1/31 changing intention, ... behaviours and behavioural intention found that the proportion of variance in behaviour explained by intention was of a similar magnitude to that found in the literature relating to non-health professionals ... for action Knowing whether intentions are low is an important part of identifying barriers to action It is in this spirit that we used intention as an important proximal determinant of behaviour...

10
225
0

báo cáo khoa học: " Which factors explain variation in intention to disclose a diagnosis of dementia? A theory-based survey of mental health professionals" potx

Danh mục: Báo cáo khoa học

... explained over 40% of variation in intention Interventions around clarifying and revising team roles may offer promising means of http://www.implementationscience.com/content/2/1/31 changing intention, ... behaviours and behavioural intention found that the proportion of variance in behaviour explained by intention was of a similar magnitude to that found in the literature relating to non-health professionals ... for action Knowing whether intentions are low is an important part of identifying barriers to action It is in this spirit that we used intention as an important proximal determinant of behaviour...

10
557
0

Báo cáo y học: " Suicide amongst psychiatric in-patients who abscond from the ward: a national clinical survey" doc

Danh mục: Báo cáo khoa học

... The National Patient Safety Agency (NPSA) has described in- patient suicides by hanging from non-collapsible rails as a ‘Never Event’, i.e an incident that should not occur if available preventative ... Abbreviations CPA: Care Programme Approach; MHA: Mental Health Act; ONS: Office for National Statistics; NPSA: National Patient Safety Agency; PICU: Psychiatric Intensive Care Unit Acknowledgements ... National Mental Health Unit [29] suggests the recording of an absconsion as a clinical incident Such post-incident reviews may then provide further knowledge of factors that lead to absconding,...

6
348
0

Báo cáo y học: " A two-year survey of the oseltamivir-resistant influenza A(H1N1) virus in Yamagata, Japan and the clinical effectiveness of oseltamivir and zanamivir" potx

Danh mục: Báo cáo khoa học

... A/ Yamagata/57/2009 A/ Yamagata/76/2009 A/ Yamagata/120/2008 A/ Yamagata/133/2008 A/ Yamagata/26/2009 A/ Yamagata/126/2008 A/ Yamagata/77/2009 A/ Yamagata/20/2009 A/ Yamagata/10/2009 A/ Yamagata/51/2009 95 A/ Yamagata/53/2009 ... A/ Yamagata/61/2009 A/ Yamagata/77/2009 A/ Yamagata/36/2009 A/ Yamagata/29/2009 A/ Yamagata/51/2009 A/ Yamagata/20/2009 A/ Yamagata/133/2008 97 A/ Yamagata/125/2008 A/ Yamagata/126/2008 A/ Yamagata/53/2009 A/ Yamagata/26/2009 ... Japan 3Sanjoh Clinic, Yamagata 996-0084, Japan Department of Infectious Diseases, Yamagata University Faculty of Medicine, Yamagata 990-9585, Japan 5Influenza Virus Research Center, National Institute...

8
382
0

Báo cáo khoa học: "A 15-year survey of reproductive efficiency of Standardbred and Finnhorse trotters in Finland descriptive results." pptx

Danh mục: Báo cáo khoa học

... the final manuscript Authors' information KN is the co-owner and chief veterinarian of the largest stud farm in Finland concentrating mainly on SB breeding She is enrolled in a PhD programme at ... for transported semen, frozen semen and in- hand natural mating For both breeds in Finland, the on-site AI was the best method; foaling rates after the use of natural mating and Unfortunately, ... semen transported to another station or home stable), 3) AI using frozen semen (only in SB), and 4) natural mating Katila et al Acta Veterinaria Scandinavica 2010, 52:40 http://www.actavetscand.com/content/52/1/40...

11
148
0

Báo cáo y học: "Estimating the number of children exposed to parental psychiatric disorders through a national health survey" doc

Danh mục: Báo cáo khoa học

... children with a parent/carer with a mental illness Australian and New Zealand Journal of Mental Health Nursing 2001, 10:221-228 Australian Infant Child Adolescent and Family Mental Health Association: ... well-being of noninstitutionalized individuals aged 15 years and older living in private occupied dwellings across the Canadian provinces, excluding those living on Crown lands and military bases ... confidence intervals are presented, and prevalence of exposure identified in the survey is projected to actual population numbers using the 2006 Canadian Census data Analysis was conducted in...

7
420
0

Báo cáo y học: "A DNA microarray survey of gene expression in" doc

Danh mục: Báo cáo khoa học

... paper Additional data file is a table listing the normal tissue specimens included in microarray analysis Additional data file is a table listing the variably expressed genes Additional data ... Expression profiling deposited research While many investigators have been using DNA microarrays to profile gene expression in cancer and other human diseases, scant data exist on profiles of gene ... mean-centering genes for each array (that is, 'global' normalization), and then by mean centering each gene across all arrays We included for analysis only well-measured genes whose expression...

9
306
0

Báo cáo y học: "Correction: A DNA microarray survey of gene expression in normal human tissues" pdf

Danh mục: Báo cáo khoa học

... feature as in (b), now displayed as transcript abundance (relative to the average transcript level for all expressed genes), calculated indirectly using the common reference mRNA versus normal female ... transcript abundance (a) Comparison of transcript levels estimated either directly by hybridization of prostate sample mRNA versus normal female genomic DNA, or indirectly by multiplying the ratio of ... occipital cortex 2271 Brain, frontal cortex 2271 Brain, frontal cortex 2272 Brain, occipital cortex 2273 Brain, occipital cortex 2272 Brain, temporal cortex 2273 Brain, frontal cortex 2273 Adrenal...

2
310
0

Báo cáo y học: " The lateral trauma position: What do we know about it and how do we use it? A cross-sectional survey of all " ppsx

Danh mục: Báo cáo khoa học

... Anesthesiology and Intensive Care, Finnmark Health Trust, Hammerfest Norway 2Norwegian Air Ambulance Foundation Department of Research Drøbak, Norway 3Kongsvinger Hospital, Innlandet Health Trust Kongsvinger, ... intubation or ordinary ETI is not an option for paramedics or general practitioners not skilled in anesthesia Unstable spinal injuries may have a devastating effect on patients, and cervical spine ... in the EMS protocols, a teaching video was made, and training and retraining was instituted locally PHTLS Norway has adopted LTP in their educational program (Sindre Mellesmo, personal communication)...

5
330
0

Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf

Danh mục: Báo cáo khoa học

... Organ site Brain Breast Breast Breast cancer adenocarcinoma (metastasis pleural effusion) Prostate metastasis Ovarian carcinoma Ductal carcinoma Breast cancer adenocarcinoma (metastasis pleural ... are reports of associations between locations of cancer breakpoints and evolutionary breakpoints [46], ESP data did not reveal a significant association in our samples (data not shown) Many of ... GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAGGACAAGTG (inner primers) For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCTTCTCATTTAG (outer primers), and TATTATGATACCCACACCAACACC and CTCCTGTTCGTGTCAGCAATAC...

17
424
0

báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx

Danh mục: Điện - Điện tử

... Mini-residency n/ a n/ a n/ a n/ a 3.1 2.2 (7) (5) Federal Medical Reserve Corps n/ a n/ a (0) Shadowing an active physician n/ a n/ a 10.6 (24) Had retraining before reentering medicine Yes Retraining experience ... evolving practice environment An individualized plan to maintain professional credentials and relationships during inactivity, moreover, may Table Reasons to reenter active medicine, by gendera Not ... retraining had been involved in what might be described as formal training for reentry; seven had been in a reentry program, and five were in miniresidencies Many more used continuing medical...

10
552
0

báo cáo hóa học: " Psychometric evaluation of the SF-36 (v.2) questionnaire in a probability sample of Brazilian households: results of the survey Pesquisa Dimensões Sociais das Desigualdades (PDSD), Brazil, 2008" docx

Danh mục: Hóa học - Dầu khí

... and informants was obtained in advance as mandated by the Code of Ethics of the International Sociological Association Data Collection Instrument The instrument used in the PDSD included, apart ... literature review, data analysis and drafted the first version of the manuscript CMT, ALN, LAA and MMV drafted the questionnaires and contributed in the analysis and interpretation of the data All ... variables that make up the scale, transforming the scales into scores ranging from to 100, and standardisation and normalisation, in which average values vary around value 50 with a dispersion factor...

10
569
0

Báo cáo khoa học: "Life-sustaining treatment decisions in Portuguese intensive care units: a national survey of intensive care physicians" pps

Danh mục: Báo cáo khoa học

... nonrespondents not differ from respondents in the examined domains, any differences would have to be considerable to alter our findings significantly Another factor in a questionnaire investigating beliefs ... physiotherapists, among others) They were also asked what measures are taken after a decision is made to withdraw therapy (e.g waiting and intervening minimally until the patient’s death, initiating palliative ... Withholding and withdrawing of life support in intensive-care units in France: a prospective survey Lancet 2001, 357:9-14 Prendergast TJ, Claessens T, Luce JM: A national survey of endof-life care...

9
405
0

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Danh mục: Y học thưởng thức

... determine the percentage of routine and non-routine radiographs that change management in our medical–surgical ICU, and to determine the specific resultant management changes Materials and methods ... defined as non-routine Changes in patient management were categorized as ETT placement or change in position, central line placement or change in position, thoracostomy tube placement or change ... 26% of routine and 40% of non-routine films changed management In surgical patients with ICU stays shorter than 48 hours, a smaller percentage of routine CXRs (17%) resulted in a change in management...

5
506
0

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Danh mục: Y học thưởng thức

... a large adequate sample size in each compared group can insure consistency between the initial design and final analysis based on symmetric CIs for estimation using a normal CI approach Second, ... is also associated with both smoking and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analysis ... selection design by comparing the consistency between the new design and a routine control selection design in a large case-control study that was incorporated into a nationwide mortality survey in...

9
532
1

Báo cáo y học: "Study of urban community survey in India: growing trend of high prevalence of hypertension in a developing country"

Danh mục: Y học thưởng thức

... Berkeley (University of California at Berkeley, California) based Fogarty International Training Program in Occupational and Environmental Health in India He is both an otolaryngologist and an epidemiologist ... awareness, treatment and control of hypertension in an eldely communitybased sample in Kerala India National Medical Journal of India 2000; 13: 9-15 Shanthirani CS, Pradeepa R, Deepa R, Premalatha ... Kalyan Sanyal is currently working as a senior consultant physician in the Maldah District, West Bengal, India Dr Sanyal completed his medical graduation in 1975, and his specialty training in Internal...

9
491
0

A NATIONWIDE SURVEY OF ENDOCRINE DISRUPTING CHEMICALS IN SOURCE AND DRINKING WATERS IN JAPAN

Danh mục: Hóa học - Dầu khí

... treatment plants are conducting periodical monitoring of monitoring items included in Japanese water quality standard Sampling points were shown in Figure Analyzed Chemicals Target chemicals are selected, ... strategies against Environmental Endocrine Disrupters by the Ministry of Environment of Japan, International Symposium on Environmental Endocrine Disruptors 2000, pp.22-23, Yokohama, Japan - 22 - ... divided into professional analytical centers and the same group of substances was analyzed in the same laboratory for all the samples Quantitative detection limits, QDLs, were determined based on variances...

6
414
0

Tài liệu The long-term reproductive health consequences of female genital cutting in rural Gambia: a community-based survey doc

Danh mục: Sức khỏe phụ nữ

... large ethnic groups in The Gambia (Singhateh 1985) A national campaign to eliminate FGC in The Gambia was launched in 1997 In the same year, the government banned national radio and television ... examination and bimanual pelvic palpation Vaginal swabs were taken and tested for Trichomonas vaginalis (TV), bacterial vaginosis (BV de®ned as Nugent score of 7+) and Candida albicans (semicon¯uent or ... Morison et al Long-term consequences of FGC in The Gambia structured questionnaire Questionnaires were forward and back-translated into the three main local languages during interviewer training, and...

11
558
0

Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx

Danh mục: Sức khỏe người cao tuổi

... an ongoing, home-based personal interview examining a national representative sample of non-institutionalized population residing in main family dwellings (households) of Spain and is mainly ... conducted in the USA [28], Australia [21], England [27] and Scotland [22] had reported a trend towards an increased PA in individuals older than 60 years of age In fact, the increase in PA has ... study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Authors’ information None Competing interests The authors...

11
912
0