mycobacterium tuberculosis treatment and the emergence of a multi drug resistant strain in the lungs
Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx
... dehydrogenase and prephenate dehydratase catalyze the biosynthesis of tyrosine and phenylalanine, respectively As this biosynthetic pathway is absent in mammals but is essential for the survival of bacteria ... encodes an intracellular CM (MtCM) Sasso et al [5], Prakash et al [6] and Kim et al [7] have characterized *MtCM Kim et al [7] have shown that *MtCM has in fact an extracellular destination in M tuberculosis ... shown, with the TSA from EcCM marking the active site The approximate positions of the N-termini and C-termini are labeled in the same color as the polypeptide chain The three helices are labeled...
- 12
- 513
- 0
báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc
... software program (QSR International, Cambridge, MA, USA) The data analysis team members will include the clinician investigators and members of the research staff trained in qualitative research ... of Year 2, a follow-up patient medical chart audit is used to examine changes in adherence to guidelines and patient clinical outcomes between baseline and Year and baseline and Year of the intervention ... Pfizer Canada indirectly through the Champlain Cardiovascular Disease Prevention Network, Canadian Institutes for Health Research, and The Ottawa Hospital Academic Medical Organization’s Innovation...
- 14
- 415
- 0
the emergence of a scientific culture science and the shaping of modernity 1210-1685 feb 2007
... of a public authority and was an unforgivable sign of disrespect and dissension, the ultimate betrayal of filial piety, of family and clan, and, above all, the betrayal of the principle of jang, ... plays a key role in understanding how science has taken on a particular foundational standing My aim in what follows is to examine the origins of and examine the rationale for a self-image of science ... Chinese As Lloyd notes elsewhere, The extant remains of Egyptian and Babylonian medicine, mathematics and astronomy can be combed in vain for a single example of a text where an individual author...
- 574
- 285
- 0
Báo cáo y học: " The role of recombination in the emergence of a complex and dynamic HIV epidemic" pptx
... to have migrated to Xinjiang along a northern drug trafficking route [26,28] CRF08 is a predominant subtype among intravenous drug users (IDUs) in Guangxi and the east part of the Yunnan province ... from India, but not Africa as India has (Additional file 1, Fig S2B) Finally, the dominant South American C epidemic appears to have derived from a single introduction from Africa ([45,46] and Additional ... cover a full HIV-1 genome of each subtype, meaning that there was a potential to form any BF recombinants in Argentina and that there was no need to assume that already-recombined genomes came...
- 15
- 259
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... operating parameters on the performance and thermal characteristics of the system Description of the multi- stage evacuated solar desalination system The Multi- stage evacuated solar desalination ... M .A. , Al-Karaghouli A. A., Minasian A. N Photochemically assisted solar desalination of saline water Desalination 1992, 86(3), 317–324 [4] Mowla D, Karimi G Mathematical modeling of solar still in ... for the maximum year round performance Each evaporator and condenser tray has an area of 1m2 inclined at an angle of 16o (a) (b) Figure Coupling of Multi- stage evacuated solar desalination system...
- 26
- 568
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... Department of Biotechnology (Govt of India) for partial financial support The authors thank Dinesh Kumar for recording the scanning electron micrographs and Shivcharan Prasad and Pinakin Makwana for ... aggregation of a- synuclein in the absence of any cellular machinery It has been proposed that the auto-oxidation product of dopamine interacts with protofibrillar a- synuclein and converts it into ... determined by the bicinchoninic acid assay [38] using bovine serum albumin as a standard protein The pooled eluate fractions were dialysed against water and then lyophilized Gel electrophoresis and immunoblotting...
- 11
- 754
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria ... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the opistoporins ... parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity...
- 12
- 598
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The South China Sea The Straits ... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman...
- 88
- 581
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... one band was amplified from each of the different samples and Southern blot analysis using the probe prepared with the lac1 primers also revealed a single band Furthermore, all of these generated ... XYL, FA and VA all induced extracellular laccase production in P sajor-caju and transcription levels of three laccase genes were increased by FA and XYL [5] Higher levels of laccase mRNA were also ... (Bio-Rad) The isoelectric point of the enzyme was determined with the Phastsystem using PhastGel IEF 3–9 operated for 410 Vh and standard pI markers (Pharmacia) The standard assay conducted in 0.1...
- 11
- 703
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT D...
- 12
- 772
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Vpr was fused in- frame with a Gal4 DNA-binding domain and used as bait in the yeast expression vector pGBT9 The GAL-4 activation domain tagged brain cDNA library (gift from Dr Srinivasan, Thomas ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... that the conformational space of b-amino acids is larger than that of a- amino acids, but low-energy conformations of the b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb ... previously introduced in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA ... Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAlaNHMe have been generated and compared to the canonical structures of the corresponding a- amino acid Ac-Gly-NHMe The corresponding SP analogues substituted in...
- 11
- 860
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... solvent In the peptide, this amino acid can be favorably replaced by Ala We speculate that in the absence of the ionic interaction in the peptide, a small, uncharged amino acid such as Ala may reduce ... result in steric hindrance with the main-chain nitrogen atom of K389, damaging the shape of the loop The above spatial arrangement explains that the HNE epitope does not form a continuous stretch of ... low, in comparison to the binding with the mAbs BH216, BH21 and BH6, suggesting that antibodies may have been partially induced against the linear isoform of the HNE peptide Although the binding...
- 13
- 492
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... the former (data not shown) Further analysis of the ORF showed that it encodes a putative polypeptide of 533 amino acids, with a predicted molecular mass of 57 kDa and a pI of 8.34 A database ... GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are indicated by an upright arrow (›) (B) The exon/intron boundaries of the split codons for arginine (between exon and exon...
- 8
- 465
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... except that SDS was excluded Proteins were stained with CBB, and cellulase was visualized by activity staining on the gel In the case of activity staining, the gel contained 0.1% (w/v) CMC and the ... N-Terminal amino-acid sequencing analysis indicated that the mature protein of P hilaris cellulase was a truncated form, which lacked a signal peptide composed of the first 21 amino acids Therefore, ... for 30 to load an SDS/polyacrylamide gel The SDS/ PAGE analysis detected three proteins bands by CBB staining and one activity band by activity staining Proteins including cellulase activity were...
- 6
- 361
- 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc
... this case, when the values of all the parameters of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the set N are strictly equal to their ... 1992), has a corollary (Wirgin, 2004): when the values of all the parameters, except PK of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the ... λ′′ , µ′ and µ′′ are real, scalar constants, with the understanding that primed quantities are related to the real part and double primed quantitites to the imaginary part of a complex parameter...
- 26
- 467
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... This analysis revealed (for both Ru and UK3 strains) the presence of a galactose residue (the additional 162 Da) in the material of peak (Fig 3A, B) and both galactose and fucose (the additional ... [23], and amino-acid analysis was carried out on a Hitachi-835 analyzer (Tokyo, Japan) in the standard mode for protein hydrolysate analysis with cation-exchange separation and ninhydrin postcolumn ... derivatives (A) Analysis of a blank sample (eluate fraction between peaks in chromatographic profile shown in Fig 3) (B) Analysis of a standard mixture containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc,...
- 10
- 398
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... were then analyzed in two separate lanes of a nondenaturing PAGE Unlabeled native pig tubulin was run in a third slot to locate the position of native dimeric tubulin The autoradiogram of the ... misfolded and unstable and therefore unable to interact with Cof A Thus, b-T1 does not acquire a native-like conformation following its interaction with cpn60, in a manner similar to mammalian actin and ... Inclan and Nogales [47] Arrows and rectangles indicate b-sheets and a- helices, respectively The labels ÔLÕ and ÔMÕ indicate residues involved in longitudinal and lateral contacts between tubulin...
- 7
- 500
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... treatment with neuraminidase (as indicated by – and +, respectively) The sialylated tetrasaccharide-containing glycoforms are indicated by an asterisk All strains were grown on media containing ... importance in strains that lack a capsular structure, which in itself provides serum resistance Recent data from our laboratory indicate that the ability of acapsular strains of H in uenzae to elaborate ... identification and structural analysis of a Sial-lNnT unit in H in uenzae LPS MATERIALS AND METHODS Bacterial strains and culture conditions The H in uenzae strain RM118 (Rd) is derived from the same source...
- 11
- 579
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student to move to any area of the site The external links in the Resources and Web Links page ... appropriateness of graphics and icons, clarity and quality of information, suitability of external links, and clarity and perceived motivating and discussion promoting characteristics of the learning ... Health Education via the Web: Design and Formative Evaluation Figure 4: An example of a Submit Page in the Web learning environment All five areas of the individual activities are available...
- 12
- 411
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25