mtann in computer aided detection of colorectal polyps and lung nodules in ct
Computer aided detection of polyps in CT colonography
Ngày tải lên :
03/10/2015, 21:57
... vertex co-ordinates of the vertices of the triangles are usually determined using linear interpolation of the values at the two points of the intersecting edge Normals can be interpolated in a similar ... Summary Colorectal cancer is the second leading cause of cancer-related death in the United States and its incidence rate is rising in developing countries Early detection and removal of polyps (the ... volume and compares the intensity profiles along these rays to the profiles corresponding to different material intersections that were analyzed and stored beforehand Once a ray detects an intersection,...
- 121
- 298
- 0
Computer aided detection of polyps in CT colonography
Ngày tải lên :
04/10/2015, 07:58
... vertex co-ordinates of the vertices of the triangles are usually determined using linear interpolation of the values at the two points of the intersecting edge Normals can be interpolated in a similar ... Summary Colorectal cancer is the second leading cause of cancer-related death in the United States and its incidence rate is rising in developing countries Early detection and removal of polyps (the ... volume and compares the intensity profiles along these rays to the profiles corresponding to different material intersections that were analyzed and stored beforehand Once a ray detects an intersection,...
- 121
- 448
- 0
Tài liệu Báo cáo khoa học: "COMPUTER AIDED INTERPRETATION OF LEXICAL COOCCURRENCES" docx
Ngày tải lên :
21/02/2014, 20:20
... Graphs and Logic in a Natural Language Understanding System, in "Natural Language Understanding and Logic Programming I I ~, V Dahl and P Saint-Dizier editors, North-Holland, 1988 120] E Way Dinamic ... speech-action mental-action consistof hand foot source _of speech-action destination _of speech-action power human speed slow mass human = Figure Examples of eollocative meaning representation in the ... Expert Using an On-line Standard Dictionary Proceedings of the IJCAI Milano, 1987 [41 K Dahlgren and J McDoweU Kind Types in Knowledge Reimesentation Proceedings of the Coling-86 1986 151 Heidorn...
- 8
- 335
- 0
Báo cáo khoa học: " Improved Automatic Detection of Zero Subjects and Impersonal Constructions in Spanish" docx
Ngày tải lên :
31/03/2014, 21:20
... of 92.0% for explicit subjects using just 20% of the training data is far more expensive in terms of the number of training instances (978) as seen in Figure (right) Actually, with just 20% of ... precision of 74% and recall u of 60%, and K-nearest neighbors in TiMBL: both in (Evans, 2001) with precision of 73% and recall of 69%, and in (Boyd et al., 2005) with precision of 82% and recall of ... the training instances that were presented to the classifier Omission of all but one of the “simple” features led to a reduction in accuracy, justifying their inclusion in the training instances...
- 10
- 406
- 0
Báo cáo sinh học: "Concomitant detection of IFNa signature and activated monocyte/dendritic cell precursors in the peripheral blood of IFNa-treated subjects at early times after repeated local cytokine treatments" doc
Ngày tải lên :
18/06/2014, 19:20
... Consistency of IFNa signature in different in vivo and in vitro settings In the attempt to unravel the “core” signature of IFNa, representative of the effect of this cytokine in vivo as well as in vitro, ... Consistency of IFNa signature in different in vivo and in vitro settings Heatmap of the 74 cDNA consistently up-regulated by IFNa in any of the in vivo and in vitro settings analyzed The lists of IFNa-up-regulated ... settings examined (Figure 5) Interestingly, although a few of these genes showed a trend of increase also in monocytes and PBMC exposed in vitro to IFNg, the induction was much stronger in terms...
- 15
- 526
- 0
Báo cáo hóa học: " Computer-aided design of nano-filter construction using DNA self-assembly" docx
Ngày tải lên :
22/06/2014, 22:20
... component strands by forming the structure shown Binding together with the other in addition to having strands that are completely paired with one another, it is also possible to have one strand a little ... than 8.9 nm in length are limited by this network Sequences analysis Sequences quality analysis In both cases of designing the sequences of hexagonal and octagonal block strands the software BioEdit ... substrates using DNA end modifications [24–29] By using this feature and designing the sequences of sticky ends one can bind the network to the proper position of the supporter frame, in order to making...
- 4
- 299
- 0
Báo cáo y học: "Segmentation-based detection of allelic imbalance and loss-of-heterozygosity in cancer cells using whole genome SNP arrays" ppsx
Ngày tải lên :
14/08/2014, 20:22
... an mBAF profile (as in Figure 1d) A method for sensitive detection of allelic imbalances in tumors should detect genomic regions containing SNPs with small but distinct differences in mBAF compared ... Illumina, SOMATICs [17] was recently reported to allow for detection of allelic imbalance in tissues containing 40-75% tumor cells Here we describe a segmentation-based strategy for detection of ... profile of chromosome for breast tumor (data set 1) with SNPs >0.97 in mBAF removed CBS segmentation profile is superimposed in red Horizontal dashed line indicates position of 0.9 in mBAF and...
- 18
- 284
- 0
Computer aided analysis of late gadolinium enhanced cardiac MRI
Ngày tải lên :
15/09/2015, 22:24
... correct spatial and intensity distortions (i.e., misalignment artifacts and inconsistent intensities) in the set of LGE images beforehand We propose 1.2 Scope and Contributions methods of handling ... heterogeneity of the myocardium and intensity similarity between the infarcts and blood pool (BP) Second, misclassification of infarcts can happen because of the intensity inconsistency and misalignment ... the intrinsic continuity of the heart throughout the stack of SA slices It realigns the slices by minimizing a joint cost combining weighted dissimilarity measurements between the intersecting...
- 169
- 636
- 0
Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance (Protocol) pptx
Ngày tải lên :
06/03/2014, 04:20
... molecular detection of tuberculosis and rifampin resistance New England Journal of Medicine 2010; 363:1005–15 Foundation Foundation for Innovative Diagnostics Automated molecular detection in 90 minutes ... significant impact on TB control through interruption of transmission and potentially earlier, more efficient diagnosis of TB, including the detection of smear-negative disease and MDR-TB In December ... users, including time to diagnosis and time to treatment initiation We will also summarize hands-on time for specimen processing and work-flow, instrument ease -of- use, and user satisfaction This information...
- 23
- 505
- 0
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt
Ngày tải lên :
30/03/2014, 20:20
... centromeric regions and NOR in chromosome II and IV are indicated with black lines, red and orange dots, respectively chores They are indicated in Fig with black lines (the first isochore in chromosome ... n by a straight line using the least square technique, ð2Þ where (z, n) is the coordinate of a point on the straight line fitted and k is its slope Instead of using the curve of zn % n, we will ... structure of A thaliana genome L.-L Chen and F Gao Table The codon usage, codon preference and amino acid usage of the genes in NOR, the mitochondrial DNA insertion isochore in chromosome II and...
- 9
- 523
- 0
Báo cáo y học: "Targeted next-generation sequencing of a cancer transcriptome enhances detection of sequence variants and novel fusion transcript" ppt
Ngày tải lên :
09/08/2014, 20:20
... settings Materials and methods Illumina library construction and sequencing A K-562 cDNA library (insert size of 290 to 390 bp) for Illumina sequencing was constructed from a 500 ng aliquot of ... provides a direct and powerful approach to discover and characterize translocations and to study their prevalence in all types of cancer [8], including solid tumors, which is an area of active research ... discovery of novel splice variants, and enabled detection of novel fusion transcripts and isoforms thereof that would otherwise have escaped detection As such, this method fills an important niche in...
- 8
- 295
- 0
báo cáo khoa học: "C60-Fullerenes: detection of intracellular photoluminescence and lack of cytotoxic effects" pdf
Ngày tải lên :
11/08/2014, 00:22
... not shown) Since cytoskeletal reorganization following integrin activation involves a series of complex signaling events beginning with integrin activation and orchestrated activation of Rho GTPases ... and vital stains Further, cells continuously cultured with C60 showed no defects in cell spreading and cytoskeletal organization, indicating the underlying cellmatrix interactions and signaling ... dishes were rinsed with phosphate buffered saline (PBS) and stained in crystal violet stain (0.25% w/v in 50% methanol) for 10 minutes Following rinsing of the dishes to remove excess stain, the dishes...
- 11
- 287
- 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
Ngày tải lên :
12/08/2014, 04:20
... (5'-3') Primer (bp) Product (bp) Nf CCCGGGTTGAAAAGCCTCGTGT 22 228a Nr GGCTTCTCCGGGTTTTTCTTCCTA 24 371f CCCGGGTTGAAAAGCCTCGTGT 22 371r TGTAACTTATCCTCCCTGAATCTG 24 a Length of product amplified by one ... was made and was repeated for three times Ct values were measured in triplicate and were plotted against the amount of infectious units (Fig 1) The inter-assay calibration curves in Fig indicate ... SVDV and VESV were preserved at virology department of Lanzhou Veterinary Research Institute, Gansu of P.R.China 65 field samples were collected from PRRSV-suspected animals during 2008 in China...
- 7
- 350
- 0
Báo cáo khoa học: " Detection of NP, N3 and N7 antibodies to avian influenza virus by indirect ELISA using yeast-expressed antigens" pptx
Ngày tải lên :
12/08/2014, 04:20
... Application of Directigen FLU-A for the detection of influenza A virus in human and nonhuman specimens J Clin Microbiol 1992, 30:1072-1075 Beard CW: To vaccinate or not to vaccinate In Proceedings of ... extracted protein Conclusion In conclusion, this study demonstrated the expression of the NP, N3, and N7 proteins of AIV in yeast (S cerevisiae) and their application in developing an indirect ... confirmed cases of influenza A (H5N1) virus infection in humans have been increased [12] Serological surveillance of antibodies against AIV is of great importance in preventing and controlling AI Identification...
- 10
- 471
- 0
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
Ngày tải lên :
12/08/2014, 04:21
... sensitive, detecting 10 copies of ssDNA plasmid, and less than 0.5 PFU of H5N1 viruses per reaction, and specific for the detection of influenza A of subtype H5 The HA gene of clades 1, 2.1, and 2.3 ... http://www.virologyj.com/content/7/1/46 Page of Conclusions We have developed a highly sensitive and specific rRTPCR assay for the detection of H5N1 influenza A virus of both clade and directly in clinical specimens, and evaluated ... virus infection and H5N1 subtyping Results Analytical sensitivity and specificity The analytical sensitivity of our LNA Taqman rRT-PCR for the detection of the HA gene of H5N1 was < 0.5 PFU of virus...
- 5
- 460
- 0
Báo cáo y học: " Multi-faceted, multi-versatile microarray: simultaneous detection of many viruses and their expression profiles" pps
Ngày tải lên :
13/08/2014, 13:20
... phosphorylation of certain amino acid residues at the amino terminal "tails" of histone H3 and/ or H4 can indeed influence chromatin structure Thus accumulating evidence has shown that chromatin-associated ... and sensitive for detecting different viral genomic sequences in cell lines Moreover, the chip could also detect the effect of various drugs on viral gene expression In such instance, cell lines ... detect viral co-infections in many different clinical settings List of abbreviations used PCR, polymerase chain reaction HIV-1, human immunodeficiency virus type ORF, open reading frame HTLV-1 and...
- 4
- 226
- 0
Development of gold nanoparticle DNA nanostructure assembly for detection of DNA, RNA and protein biomarkers
Ngày tải lên :
09/09/2015, 11:16
... binding of the ER, and which formed the basis for the detection of ER The interaction between dimers and ER was translated into a unique complex peak signature observed on the DLS; Understanding ... affect the condition of a disease in individuals, the actual manifestation of the effect is typically due to the presence/absence of nonfunctioning/functional proteins, which have a impact on ... nanostructures [88] The use of conjugates of defined structures in the construction of nanoassemblies is the focus of discussion in the next section 2.2.2.4 Building blocks for nanostructure formation/...
- 142
- 369
- 0
Analysis and detection of human emotion and stress from speech signals
Ngày tải lên :
15/09/2015, 22:03
... vector of cell i in self organizing map c winning neuron Nc neighbours of winning neuron fi center frequency of i subband bi bandwidth of i subband α logarithmic growth factor C bandwidth of ... performance of an ASR system and to produce a better human-machine interaction system In developing method to detect stress and emotion in speech, the causes and effects of stress and emotion in human ... stress and emotion have impact on human vocal characteristics In the following section, the effect of social and cultural aspects on characteristics of emotional speech is discussed 2.3 Social and...
- 230
- 222
- 0
univ of minnesota pr mathematical models in the health sciences a computer aided approach nov 1979
Ngày tải lên :
11/06/2014, 16:42
... calculus and advanced training in some health science or biomedical field A knowledge of biostatistics and computer programming may be useful in following some of the detailed examples Readers may find ... results in part from the difference between the experience of biomedical scientists and of engineers and physical scientists in representing and analyzing various phenomena In addition, the original ... blood into which radio-iodine-labeled T4 was introduced In this preparation the radioactivity of the liver and blood are monitored as a function of time Cumulative radioactivity of bile collected...
- 372
- 843
- 0