... general, the main differences between standard and high grades of analog camcorders are image and audio quality High grade formats noticeably increase image resolution and audio fidelity over standard ... twice as fast as in its analog relatives, and the signal is digital The Digital8 format is backward-compatible with the analog mm format That’s a big plus if you have a closetful of legacy mm gear ... permanent damage to the camera or personal harm to you We recommend that you always (and only) have your video camera repaired by a trained professional 21 All About Lenses Jim Stinson Without passing...
... Primer name Sequence (5'→3') Sense ATACCGTCCCACCATCGGGC Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT 3 0A CCCCTATCCTTTCCGCGTCCTTACTTCCCC 30C GGGGAAGTAAGGACGCGGAAAGGATAGGGG 12 Following incubation, virus ... uses a carboxyl and amine-reactive small molecule, EDC, as a catalyst to react with a carboxyl group first that then forms an unstable intermediate that reacts with a primary amine to form an amide ... A catalyst is used to activate the side chain of a specific amino acid that then forms an intermediate This intermediate then acts as a nucleophile and attacks the side chain of an adjacent amino...
... activated carcinogens can bind to DNA and form DNA adducts that are capable of inducing mutations and initiating carcinogenesis The capacity to repair DNA damage induced by activated carcinogens 61 appears ... Tanaka K, Miura N, Satokata I, et al Analysis of a human DNA excision repair gene involved in group A xeroderma pigmentosum and containing a zinc-finger domain Nature 1990; 348: 73-6 65 Sarasin ... a meta-analysis The idea of adjusting the results of meta-analyses for publication bias and imputing "fictional" studies into a meta-analysis is controversial at the moment [34] Sutton et al concluded...
... reagent The phosphorus accumulation was assumed to be uniform in all the leaves, and the total amount of the accumulation was evaluated from the total leaf area During the measurements, plants ... seasonal variation of phosphorus uptake by an ideal one-dimensional giant reed cultivated waterway (Fig 7) In this simulation, the loading phosphorus concentration and water loading rate were assumed ... Cultivated Waterway based on Estimated Imax and Km (phosphorus concentration in loading water = 2.5 mg-P/L; water loading rate = 0.6 m/day) Phosphorus Accumulation and Translocation in the Giant...
... Calcutta, India, as the only son of Richmond Thackeray After his father death, and his mother’s remarriage with Major Henry Carmichael Smyth, Thackeray was sent to England and educated at Charterhouse ... Oliver was starved and exhausted He met Jack Dawkins who was at Oliver’s age Jack took Oliver to the house of his benefactor, Fagin It turned out that Fagin was a professional criminal who trained ... determination, intelligence, hard work and talent She is an unscrupulous trickster, a liar, a cheat, a schemer, manipulator, a gambler, a hypocrite, a betraying wife and friend, and a callous...
... whether to splice or patch (connect) cables Again, many service providers have their own rules and standards In a patch, the cable is brought above ground into a patch cabinet The alternative is to ... directions, there are advantages in having patch cabinets, at least in certain locations Again, it’s incumbent upon the planner to decide where advantage is gained from connectorization in the network ... difficult than pulling a 144-count cable through Running smaller cables would also provide an easier means to achieve redundancy, as we’ll discover later in this paper Page Practical considerations...
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred to Immobilon-P ... HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ Small bold letters refer to the...
... and AMP (The SD is less than 15%; n ¼ 5) LPS (lgÆmL)1) Animals S domuncula tissue Sea Aquarium Aquarium Aquarium Aquarium Aquarium Aquarium Aquarium S domuncula primmorphs Aquarium Aquarium Aquarium ... and methods Lane a: S domuncula (aquarium animal); lane b: S domuncula (sea animal); lane c: G cydonium (sea animal) Lane a and b: mg of total protein per assay, synthesis time 12 h; lane c: mg ... melanogaster (Advanced BLAST available from http:// www.ncbi.nlm.nih.gov/blast/blast.cgi); a related enzyme is also lacking in yeasts (e.g Saccharomyces cerevisiae) or plants (Arabidopsis thaliana)...
... bureaucratization of life imposed by the socialist and welfare states has been a set back It is an expression of capital’s power to refuse all social contract, to de facto abrogate all contractual relations, ... Negri maintain it has reconstructed it as a pyramidal structure, increasing inequality and polarization, and deepening the hierarchies that have historically characterized the sexual and international ... necessities all have been slashed, axed, gutted As a consequence, life expectancy is falling and phenomena have reappeared that capitalism was supposed to have erased from the face of the earth long ago:...
... United Kingdom Total (1 In EUR millio ns fo r EFA M A members fo r which data are available ) EFAMA Quarterly Statistical Release N°46 (Second Quarter of 2011) Trends in the European Investment ... EFAMA Quarterly Statistical Release N°46 (Second Quarter of 2011) Trends in the Non-UCITS Market Net Sales and Assets by Investment Type Total non-UCITS assets increased by 1.0 percent to stand ... r EFA M A members fo r which data are available; (2) including funds o f funds, except fo r France, Germany and Italy fo r which the funds o f funds data are ) included in the o ther fund catego...
... Balanced Funds of funds (4) Other Total (excl Ireland & Netherlands) of w hich guaranteed funds Total (incl Ireland & Netherlands) 35,766 (1 No full data breakdo wn is available fo r Ireland and ... millio ns fo r EFA M A members fo r which data are available ) EFAMA Quarterly Statistical Release N°50 (Second Quarter of 2012) Trends in the European Investment Fund Industry Net Assets by Country ... funds EFAMA Quarterly Statistical Release N°50 (Second Quarter of 2012) Trends in the UCITS Market Net Assets by Country of Domiciliation Total UCITS net assets remained relatively flat in the...
... activity as described earlier Statistical analyses For multiple comparisons statistical analysis was performed using one-way analysis of variance (ANOVA) followed by a Newman–Keuls post-test Data analysis ... pathways Am J Physiol 36, E28–E36 Kaburagi, Y., Satoh, S., Tamemoto, H., Yamamoto-Honda, R., Tobe, K., Veki, K., Yamauchi, T., Kono-Sugita, E., Sekihara, H., Aizawa, S., Cushman, S.W., Akanuma, ... phospho-specific antibodies against PKB and GSK 3a/ b As a loading control, lysates were immunoblotted with an antibody to native PKBa The blots are representative from up to three separate experiments Alternatively...
... a theory that bridges what used to appear as a saltus naturae, a logical explanation displacing a shamefaced resort to miracle, has so much to recommend it that one hates to challenge it on any ... a mistaken view of causality After all, a savage who beats a tom-tom to drive off his brother's malaria would never make such a practical mistake as to shoot his arrow blunt end forward or bait ... supposed to be the abundance of their strength after their needs are satisfied Yet artists as a class are so ready to sacrifice wealth and comfort and even health to their trade, that a lean and hollow...
... this type of contamination can spread overa large area Contamination also can originate over large areas from sources such as leaking water and sewer lines, stormwater runoff, and atmos- pheric ... due toa lack of toxicity information Measured contaminant concentrations may be compared to HBSLs to evaluate water-quality data in a humanhealth context Such comparisons can provide an early ... necessarily an exact measure of a VOC source that is contributing a VOC to ground water Although preferable in this analysis, national data sets of releases for all VOC groups are not available Additionally,...
... heritage artefacts and keep them available, in as satisfactory a condition as possible for future generations is a very significant challenge For the examination, characterisation, and analysis ... dedicated to cultural heritage artefacts analysis AGLAE (Accộlộrateur Grand Louvre pour lAnalyse Elộmentaire) is a National Electrostatics Corp tandem accelerator (2 MV) Figure shows the end-stations ... He has been a researcher at the ENEA (the Italian nuclear authority) and was the Director of a Research Centre with two experimental reactors He was also an Expert of the United Nations (IAEA)...
... scans and the stage of the cancer was also determined If the short diameter of a lymph node was greater than cm, this was taken to indicate metastatic lymphadenopathy Twenty-one of the 51 patients ... Thorac Cardiovasc Surg 1968;56:362-370 11 Gopalakrishnan P, Miller JR, Mclaughlin JS Pulmonary TB and coexisting carcinoma Am Surg 1975;41:405-408 12 Ben M’Rad S, Azzabi S, Baccar MA, Aouina H, ... negative B Chest radiograph obtained two years after A demonstrates increased opacity (arrow), which was disregarded by both the radiologist and the patient’s clinician C Follow-up CT scan obtained...
... 1540–1548 27 Araki W, Takahashi-Sasaki N, Chui DH, Saito S, Takeda K, Shirotani K, Takahashi K, Murayama KS, Kametani F, Shiraishi H et al (2008) A family of membrane proteins associated with presenilin ... Sigma A rabbit anti-APH1aL antibody was purchased from COVANCE (Berkeley, CA, USA) Anti-PEN-2 IgM was provided by Dr Thinakaran [27,28] Anti -a- tubulin and anti-calnexin IgG were purchased from Santa ... The Authors Journal compilation ª 2009 FEBS 5839 Synoviolin is involved in the degradation of nicastrin T Maeda et al 23 Sai X, Kokame K, Shiraishi H, Kawamura Y, Miyata T, Yanagisawa K & Komano...
... Biomphalaria glabrata, the planarian Schmidtea mediterranea, and the sea anemone Nematostella vectensis However, human pFGE and also pFGE from 20 further mammalian species (from various primates to ... L Gande et al of a fatal nature that is characterized by the synthesis of catalytically inactive sulfatases lacking FGly [12,13,16,17] All multiple sulfatase deficiency patients analyzed so far ... SGEL instead of PGEL, pFGE cDNA [23] served as a template for an add-on PCR using 5¢-CTAGCTAGCCACCATGGCCCGGCAT GGGTTAC-3¢ as a forward primer, and reverse primers 5¢-TCTAGAGATATCTACAGCTCCCCTGGCG-3¢...
... we aim to ‘package’ and ‘sell’ ourselves in a way that enhances our career prospects Moreover, in relation to personal aesthetics, Hopfl (2000, p 197) has argued that ‘the cultivation of appearances, ... presentation and appearance to be very important Personal presentation and appearance was ranked 3rd both now and in the future, making it more important than even employees’ ability to follow ... in and able to afford high price lattes and cappuccinos at the style bars, cafes and ´ restaurants And they will want these places, its hardware (that is the physical environment) and software...