... dysfunction.ACKNOWLEDGEMENTSWe thank Drs Carlos E. Argaran˜ a and Mario Guido for criticalreading of the manuscript, Mrs S. N. Deza and Mrs M. G. Schachnerfor technical assistance and Dr Stephen Anderson ... Secretarı´adeCienciayTe´cnicadelaUniver-sidad Nacional de Co´rdoba y Agencia Co´rdoba Ciencia del Gobiernode la Provincia de Co´rdoba, Argentina.REFERENCES1. Barra, H.S., Arce, C .A. , ... into alpha-tubulin by recombinantmammalian tubulin-tyrosine ligase. Biochim. Biophys. Acta 1481,131–138.13. Fukuyama, N., Takebayashi, Y., Hida, M., Ishida, H.,Ichimori, K. & Nakazawa,...
... mechanochemicalnature of a- CT catalysis A more detailed analysis of the influence of chemicalglycosylation on the dynamics of a- CT from the theor-etical simulations was additionally performed to gain a deeper ... modeled.Table S4. Average rmsd (A ˚) for the conserved catalyticresidues calculated from MD simulations of a- CT andthe various Lac -a- CT conjugates modeled.This material is available as part of ... were calculated with YASARA’s analysis module.Gaussian network model analysisGNM analysis represents a simplified version of normalmode analysis for describing the fluctuations in dynamics of polymer...
... kDa), alcohol dehydrogenase (a, 141 kDa) andcatalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers.Novel aggregate formation of an alkaline phosphatase frame-shift ... fraction).BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) wereloaded on to a separate gradient as mole-cular mass markers.K. Komaru et al. Novel aggregate formation of an alkaline ... Lafferty MA, Slaughter C,Raducha M & Harris H (1986) Isolation and characteri-zation ofa cDNA encoding a human liver ⁄ bone ⁄ kid-ney-type alkaline phosphatase. Proc Natl Acad Sci USA83,...
... r a ịwhere rnand ruare the experimentally determinednumerical values of the ratio a/ b, and r a is the theoreticalnumerical value of ratio a/ b for a mixture of aromaticamino acids (Tyr and ... not mark any as pooror inappropriate. Another structural analysis, obtained bytheVERIFY3Dprogram [61], gave an average value of 0.21,which is greater than zero, the quality value indicated ... removing NaClby prolonged dialysis, this protease is activated and cleavesPsbQ at low salt concentrations. We circumvented thedrawbacks of the 1-MNaCl wash by taking advantage of the Cu2+effect....
... mutagenesis reactions together with oligonucleo-tides ECF-Q69G d(5Â-AACAACGCAGCTGGGCTCTGGAACCAT), ECF -A1 41Q d(5Â-TCAACCTCTAACCAGGCTACTCCGCTG) ECM-G77Q d(5Â-AACAACGCTGGCCAGCACGCTAACCAC) and ... purchased fromPharmacia Biotech (Vienna, Austria).Visualization and analysis of molecular structuresMolecular structures whose coordinates were obtainedfrom the RCSB database were visualized ... in parentheses.bActivity of SOD expressed on a per-iron metal basis (iron superoxide dismutase mutants) and per-manganese metal basis (manganesesuperoxide dismutase mutants).Table 2. Metal...
... described as medians with rangesin parentheses. The significance of changes was evaluated us-ing analysis of variance (ANOVA) for parametric variables andthe Mann–Whitney test for nonparametric variables.RESULTSFour ... None had a fistula. Median duration of Crohn’sdisease was 3 years (range, 1–5). All patients were takingprednisone at entry, with a median dose of 22.5 mg(range, 15–50 mg). All patients had also ... features and disease activity were assessed atbaseline and at 1, 4, 12, and 24 weeks of LGG therapy. ThePCDAI was calculated at each visit. Stools were cultured ateach follow-up visit to assess...
... here and is present in theS. agalactiae PPase, kinase and adenylosuccinate syn-thase, but not in S. agalactiae CovR ⁄ CsrR. The motif is located at the surface of the SaPPase (Rantanen,unpublished), ... with a pK a of 7.5[11] to achieve catalysis, a common feature in hydro-lytic metalloenzymes [12]. One residue that appears totake part in catalysis in HsSTP is His62, which mayact as a general ... fused to an EF-hand motif, and human STP(HsSTP), which has an additional 8 kDa a- helicaldomain at the C-terminus [3,4].The sizes of the catalytic domains of both PPP andPPM families are well...
... [e.g.cerato-platanin of Ceratocystis fimbriata f. sp. platani,Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path-ogenesis-related proteins (As-CG of ... Stability of clades was evaluated by 1000 bootstrap rearrangements.Bootstrap values lower than 20% are not displayed in thecladogram.RNA isolation and hybridizationFungal mycelia were harvested ... helices, separated by a 14amino acid strand.interproscan analysis [22] of Epl1 showed the affi-liation of this protein to the cerato-platanin family(IPR010829). This isa group of low molecular weight,4-cysteine-containing...
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...
... from a malignant murine mast celltumor and rat mesencephalic tegmentum. Arch. Biochem. Biophys. 199, 355–361.13. Hasegawa, H., Yanagisawa, M., Inoue, F., Yanaihara, N. &Ichiyama, A. (1987) ... University of Science and Technology, Uenohara,Yamanashi 409–0193, Japan. Fax: + 81 554 63 4431,E-mail: hasegawa@ntu.ac.jpAbbreviations: TPH, tryptophan hydroxylase; CaM kinase II,calcium/calmodulin-dependent ... Kojima, M., Oguro, K., Sawabe, K., Iida, Y., Ikeda, R.,Yamashita, A. , Nakanishi, N. & Hasegawa, H. (2000) Rapidturnover of tryptophan hydroxylase is driven by proteasomes inRBL2H3 cells, a...
... this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This isa timely discourse as the vast ... being available anywhere, at anytime and on any device.If it was only a simple as a mouse-trap.The complication is that for most customers they already have an IT investment. So the assessment ... the traditional performance measure is not relevant because it doesn’t factor in agility/flexibility. Attempts to incorporate this into the traditional performance measure are absurd. It is pure...
... couldn't find any list of where all the fab labs in the world were or what a fab lab was or is it an organisation, is it just a name, is it just a casual name, you know, like a I don't ... literature, there are a number of examples of Fab Lab projects. Mikhak et al. (2002) report on projects in India, at Vigyan Ashram Fab Lab just outside the village of Pabal in Maharashtra, and at ... logistics, lack ofa central Fab Lab organisation, lacking outreach to society at large, too strong a focus on technology 11 100.00% Table 7: The pain of Fab Lab managers and assistants...
... 3). (B) Analysis ofa stan dard mixturecontaining Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc. (C) Analysis of peak 1 (Fig. 3A) . (D) A nalysis of peak 2 (Fig. 3A) .3140 L. A. Baratova et al.(Eur. ... virion surfaceLyudmila A. Baratova1, Nataliya V. Fedorova1, Eugenie N. Dobrov1, Elena V. Lukashina1,Andrey N. Kharlanov2, Vitaly V. Nasonov3, Marina V. Serebryakova4, Stanislav V. ... Combined MALDI mass spectrum of material from peaks 3*, 1 and 2 after partial CPY hydrolysis. (C) M ALDI massspectra of p eak 2* mater ial before (upper part) and after (lower part) CPY treatment...
... PKN, and rhophilin in the rho-bindingdomain. J. Biol. Chem 271, 13556–13560.15. Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A. ,Fujita ,A. ,Watanabe,N.,Saito,Y.,Kakizuka ,A. ,Morii,N.&Narumiya, ... PRK2 kinase isa potentialeffector target of both Rho and Rac GTPases and regulates actincytoskeletal organization. MolCellBiol.17, 2247–2256.13. Watanabe, G., Saito, Y., Madaule, P., Ishizaki, ... Furuyashiki, T., Ishizaki, T., Watanabe, G., Watanabe,N.,Fujisawa,K.,Morii,N.,Madaule,P.&Narumiya,S.(1996)Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase,...