monoclonal antibodies for the treatment of type 2 diabetes a case study with glucagon receptor blockade
METFORMIN – MORE THAN ‘GOLD STANDARD’ IN THE TREATMENT OF TYPE 2 DIABETES MELLITUS
Ngày tải lên :
12/07/2015, 15:49
... hyperglycemia in type diabetes: a consensus algorithm for the initiation and adjustment of therapy: a consensus statement of the American Diabetes Association and the European Association for the Study of ... THAN ‘GOLD STANDARD’ IN THE TREATMENT OF TYPE DIABETES MELLITUS 16 Halimi S, Le Berre MA, Grange V Efficacy and safety of acarbose add-on therapy in the treatment of overweight patients with type ... in 1 922 (6), and was a basis for further experimental and clinical studies on the potential therapeutic application of biguanides, particularly metformin The other two biguanide agents, phenformin...
- 10
- 420
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
Ngày tải lên :
26/10/2012, 09:32
... men; mean age 64, range 22 -89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients ... Iwatsuki et al reported significant pain relief in 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three ... follow-up; 40% of patients had relief for at least 12 months, and mean duration of pain relief was 14 months Barlocher et al treated 50 patients with cryorhizotomy of the medial branch At 1-year follow...
- 4
- 599
- 0
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
Ngày tải lên :
31/10/2012, 16:49
... TM, Harris SB, Harris-Giraldo R, Hanley AJ, Zinman B Specific patterns of food consumption and 19 20 21 22 23 24 25 26 preparation are associated with diabetes and obesity in a Native Canadian ... P, Harkanen T, Jarvinen R, Heliovaara M, Aromaa A et al Dietary patterns and the incidence of type diabetes Am J Epidemiol 20 05; 161(3) :21 9 -22 7 Tables Table 1: Total meat*, red meat, poultry and ... included in this analysis For other participants the average of the baseline and follow-up FFQ data were used in the analyses The average daily intake of individual food items (g/day) was combined...
- 8
- 701
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
Ngày tải lên :
20/06/2014, 04:20
... serial cast manipulation were from the 13 -24 weeks of the age group while beginning of the treatment, while was from the 25 -36 weeks of the age at the initiation of the treatment Thus, relapse ... DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and ... children - 28 .57% (19 feet - 28 .35%) had a relapse of the deformity Patient age at the time of relapse, bilateralism or unilateralism of the relapse foot, relapse foot deformity, treatment offered...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
Ngày tải lên :
20/06/2014, 07:20
... serial cast manipulation were from the 13 -24 weeks of the age group while beginning of the treatment, while was from the 25 -36 weeks of the age at the initiation of the treatment Thus, relapse ... DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and ... children - 28 .57% (19 feet - 28 .35%) had a relapse of the deformity Patient age at the time of relapse, bilateralism or unilateralism of the relapse foot, relapse foot deformity, treatment offered...
- 7
- 802
- 0
Báo cáo y học: "Association of Adiposity, Cardiorespiratory Fitness and Exercise Practice with the Prevalence of Type 2 Diabetes in Brazilian Elderly Women" pot
Ngày tải lên :
08/08/2014, 16:23
... in the U.S., 20 00 -20 02 Diabetes Care 20 05; 28 : 1599-1603 Nasri F Diabetes Mellitus no Idoso In: Freitas EV et al, eds Tratado de Geriatria e Gerontologia Guanabara Koogan, 20 02: 496-501 Kanaya AM, ... professionals should encourage individuals of all ages to maintain an active life-style that can attenuate the negative physiologic changes that accompany advancing age, leading to T2D The main limitation ... 69: 20 04 -20 11 Selvin E, Coresh J, Brancati LB The burden and treatment of diabetes in eldely individuals in the U.S Diabetes Care 20 06; 29 :24 15 -24 19 International Diabetes Federation Global strategic...
- 5
- 426
- 0
Oral rivaroxaban for the treatment of symptomatic venous thromboembolism (a pooled analysis of the EINSTEIN DVT
Ngày tải lên :
30/08/2015, 13:24
... period of 3, 6, or 12 months Day Day 21 Rivaroxaban Rivaroxaban 15 mg bid 20 mg od N= 828 2 R PE with or without DVT2 N=4833 Enoxaparin bid for at least days + VKA, INR 2. 0–3.0 Primary efficacy outcome: ... 19/ 826 2. 3 Intermediate 47/1941 2. 4 50/19 42 2.6 Extensive 28 / 121 8 2. 3 25 /1190 2. 1 Limited 25 % of vasculature of a single lobe, popliteal vein only multiple lobes and >25 % of entire pulmonary vasculature; ... classified as: Active cancer at baseline (diagnosis or treatment < months or recurrent or metastatic cancer) Active cancer during the study (a new diagnosis of cancer) A history of cancer...
- 22
- 288
- 0
Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model
Ngày tải lên :
11/09/2015, 09:05
... cells for therapeutic use The ease with which they are harvested (i.e as a simple marrow aspirate) and the ease of their culture and expansion in vitro make MSCs a good candidate for cell therapy ... reduce the inflammatory response in the brain Although current anti-inflammatory drugs are of great value in the treatment of PD, the disadvantage is that the use of them is systemic and they not ... increases with age (Tan et al., 20 04) .The neuropathological hallmarks are characterized by progressive loss of dopaminergic neurons in the substantia nigra pars compacta (SNc) with the presence of...
- 200
- 311
- 0
Aspects of carbohydrate quality and their relevance for risk markers of type 2 diabetes and related health outcomes
Ngày tải lên :
25/11/2015, 14:52
... homeostasis model assessment IR (HOMA-IR), alanine-aminotransferase (ALT), and gamma-glutamyltransferase (GGT) in a subsample of the DONALD Study (n =22 6 and n =21 4, respectively) In Study III, again ... when a total prevalence of 0.41% was estimated Even if the data has to be evaluated with caution because of the low precision of diabetes estimates [68], the proportion of T2D cases of the combined ... over the age of 18 years are overweight and 23 .9%, and 23 .3%, respectively, are obese Thereby, prevalence increases with age group [99] For Australia, the Australian Health Survey 20 11 -20 12 revealed...
- 203
- 431
- 0
Báo cáo y học: "The opposite effects of fluvoxamine and sertraline in the treatment of psychotic major depression: a case report" potx
Ngày tải lên :
08/08/2014, 23:21
... Chiba University Center for Forensic Mental Health, Chiba, Japan 20 21 22 23 Received: 22 April 20 10 Accepted: 21 May 20 10 Published: 21 May 20 10 © 20 1 0of Open Access from: http://www.annals-general-psychiatry.com/content/9/1 /23 ... Ishikawa M, Ishiwata K, Ishii K, Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after ... monotherapy was maintained, and her condition remained good At years after the disappearance of the delusions, the patient began overeating and oversleeping, as well as experiencing premenstrual...
- 3
- 401
- 0
báo cáo khoa học: "Predictive genetic testing for the identification of high-risk groups: a simulation study on the impact of predictive ability" pot
Ngày tải lên :
11/08/2014, 12:21
... 12 14 16 18 20 22 24 26 28 Percentage 25 (a) Percentage Percentage 25 simulations All analyses were performed using the R programming language version 2. 8.0 [19] OR =2. 0 0 10 12 14 16 18 20 22 ... genetic variants, the theoretical range of the risk score was to 100, but the observed range was to 32 with a median of 15 risk alleles The AUC for the risk scores was 0. 62 when the OR of each included ... factors, each having a risk genotype with a frequency of 30% and an OR that varied across scenarios (that is, 1.1, 1.5 and 2. 0, respectively) Simulation study of age-related macular degeneration...
- 8
- 379
- 0
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY
Ngày tải lên :
07/09/2013, 13:45
... confiding the attention to those aspects that are relevant to the research problem at the time (Johnson 19 92) A case is a unit of analysis, for example, in education research, a case is probably a learner, ... assumptions and It offers valuable practice for the exam Students learn what they use and forget what they not use Table 2: Claims of the formal curricula Analyzing the curricula, the researcher focused ... attainment of accurate pronunciation in a second language is a matter substantially beyond the control of educators’ They qualified their findings by stating that variables of formal training and...
- 40
- 984
- 4
Báo cáo y học: "A comprehensive platform for quality control of botanical drugs (PhytomicsQC): a case study of Huangqin Tang (HQT) and PHY906" potx
Ngày tải lên :
13/08/2014, 15:21
... peaks but rather on the ratio data computed for each of the N data points with each of the other (N-1) data points Using these (N-1) ratio values in the computation for each of the N data points ... threshold of 1%, 82% of the TIC at a threshold of 1.5% and 87% of the TIC at a threshold of 2. 0% A list of these 39 phytochemical peaks is in Additional file Marker standards Quantitative analysis was ... the National Cancer Institute (NCI) (CA-63477) of the National Institute of Health USA and the National Foundation for Cancer Research We also acknowledge that a small subset of the data and descriptions...
- 15
- 303
- 0
TOPICS IN THE PREVENTION, TREATMENT AND COMPLICATIONS OF TYPE 2 DIABETES pptx
Ngày tải lên :
27/06/2014, 18:20
... have showed that the residues at positions 15 21 and 24 – 32 are involved in the beta-sheet formation and that the turn at positions 22 and 23 plays a crucial role in the aggregation of Abeta 42 ... declines with aging and in agerelated diseases, such as diabetes and AD (Calabrese et al., 20 01) Some data show the existence of an age-related impairment of the respiratory chain and an uncoupling of ... Alzheimer’s Disease and Type Diabetes: Different Pathologies and Same Features Marta Di Carlo1, Pasquale Picone1, Rita Carrotta2, Daniela Giacomazza2 and P.L San Biagio2 1Istituto di Biomedicina e Immunologia...
- 352
- 478
- 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
Ngày tải lên :
10/08/2014, 10:21
... from the analysis Treatment Patients at relapse had received cycles of FCR: fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of ... Patients had received at least one prior treatment, were age ≥ 18 years, with WHO performance status of to 2, had achieved at least PR at the completion of FCR; the last chemotherapy with or without ... and physical examinations OS was calculated from the date of FCR treatment to the date of death from any cause; OS was analyzed by using the Kaplan-Meier method Results Patients characteristics...
- 5
- 287
- 0
SURGICAL OPTIONS FOR THE TREATMENT OF HEART FAILURE - PART 2 pdf
Ngày tải lên :
11/08/2014, 15:20
... with a 5-year survival of only 28 % The CABG patients had a relatively high operative mortality of 20 % but achieved a 5-year survival of 80% For tiansplantation, operative mortality was 11.6%) and ... 16 17 18 19 20 21 22 23 24 25 26 27 28 CASS Principal Investigators Coronary Artery Surgery Study (CASS): A randomized trial of coronary artery bypass surgery Survival data Circulation 1983;68:939-50 ... chronic phase of heart failure."'"' Additionally, high levels of plasma catecholamines for a prolonged period of time can attenuate the function of the Padrenergic receptor pathway The failing heart...
- 20
- 433
- 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
Ngày tải lên :
25/10/2012, 10:02
... to the ACC/AHA criteria [26 ,27 ] Statistical analyses MedCalc™ v 9.6 .2. 0 (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are ... Jr: ACC/AHA guidelines for the management of patients with unstable angina and non-STsegment elevation myocardial infarction A report of the American College of Cardiology/American Heart Association ... pregnancy Jama 20 05, 29 4 :27 51 -27 57 49 Kim C, Newton KM, Knopp RH: Gestational diabetes and the incidence of type diabetes: a systematic review Diabetes Care 20 02, 25 :18 62- 1868 50 Ben-Haroush A, ...
- 8
- 656
- 1
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"
Ngày tải lên :
26/10/2012, 09:57
... approach requires a transthoracic approach with close proximity to the major abdominal and thoracic organs and neurovasculature [4], and posterior approaches require subperiosteal of the paraspinal ... Med Sci 20 09, 22 5 central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch Materials and Methods Twelve patients were treated with endoscopic ... older age than patients with cervical or lumbar disease Also, the stenosis tends to be foraminal and not central since 66% of patients had foraminal stenosis The lower thoracic spine appears to...
- 3
- 506
- 0
Báo cáo y học: "Efficiency of vibration exercise for glycemic control in type 2 diabetes patients."
Ngày tải lên :
26/10/2012, 10:04
... computations Statistical analysis Statistical analysis was conducted using SPSS version 12. 0 for Windows If not otherwise stated data are expressed as mean and standard deviation The data were analyzed ... by analysis of variance for repeated measurements (factors: time and training form) In case that the two-factorial analysis yielded a significant result (p < 0,05), a Newman-Keuls test was performed ... significant for VT Figure 2: Mean heart rates at loads corresponding to a lactic acid concentration of mmol / l gray bars = pretraining, black bars = posttraining mean ± SE Strength The relative maximal...
- 5
- 544
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
Ngày tải lên :
05/09/2013, 09:38
... step to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS 126 9r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter ... the laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20 oC Another was for ... the cause of partial nitriifcation, the authors operated a test plant using simulated coak-oven wastewater prepared with chemical reagents for a period of about one year The nitrifiers population...
- 8
- 572
- 0