... meal was mixed and then 15 g was removed with a spatula for disk samples and about g for extreme value samples and placed in a sample cup After the samples had been scanned under a near infrared ... plant breeding), values of and upward are suitable for quality control analysis, and values of above are excellent, and can be used in any analytical situation RESULTS The RMS values obtained for ... mean An RPD below cannot give a relevant prediction An RPD value of 2.0–3.0 is regarded as adequate for rough screening A value of above 3.0 is regarded as satisfactory for screening (for example...
... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ...
... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... of each sample was incubated with the reagents provided with the kit in a 96-well plate The amount of Ca 2+ was measured using the BioRad iMark Microplate Reader (Bio-Rad, Hercules, CA, USA) and ... cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange between pollen and stigma Ca2+ ions are more abundant in the receptive stigmas...
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... the one they thought was correct (identification) (for more information on the test, see (Thomas-Danguin et al., 200 3a) ) Data analysis Repeated measures analysis of variance was used to test the...
... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used asa surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... denaturant asa selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a ... 2:1 Jlactate ðalas Þ ¼ 0:919 à ð129 À alas Þ Ã ð1 À eÀ6Ãalas Þ À 75:2 (User 3:3 defined), Jacetate ðalas Þ ¼ 0:1135 à ðÀ30:3 À alas Þ Ã ð1 À eÀ6Ãalas Þþ 4:66 (User defined), Jformate ðalas Þ ¼...
... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...
... like mercapturic acid, glucoronic acid as well as acetyl-/diacetyl isocyanate diamines to corresponding MDA, HDA, TDA, NDA and IPDA For the current analysis, all patient samples, standards and controls ... estimated with standard curves for each individual isocyanate-amines’ run in parallel Analytical standards for each individual diamine were used to prepare standard Page of calibration curves (7 ... Han DH, Baillie TA: Biotransformation of methyl isocyanate in the rat Evidencefor glutathione conjugation asa major pathway of metabolism and implications for isocyanate-mediated toxicities...
... rate, an environmental crisis will lead directly to a human crisis The forests of Vietnam provide sanctuary for an amazing range of floral and faunal species Rare and endangered species such as ... and potassium (NPK) content than any other domestic manure, with a 20:16:9 NPK ratio Sheep and goat manure have a ratio of 19:7:20; cattle manure has an NPK ratio of 12:3:9; and pig manure has ... seedbeds, and for storage of soil and organic material k have shade in the work area to protect both workers and plants k have a fence, ideally a living fence and be located in an area that is protected...
... method was also described for determining the tree diameter at breast height (Bitterlich 1996) For testing the accuracy of the method the laser telemeter was used and then the measured diameter was ... of the angle gauge (b) b a (a) α borderline Table Average values and their differences Diameter measured optically with wedge prism Diameter measured with calliper Difference Standard deviation ... the distance when the blocks were on the borderline The distance was measured using the laser telemeter with half -a- meter scale The diameter was calculated and compared with the control measure...
... performed in September 1998, with the aim of estimating the maximum annual impact of water stress in areas at different levels of landscape degradation a Istanbul Ankara Bursa Izmir Antalya Adana ... of at least 15 leaves per species each daytime was measured from different trees Leaves were cut off while within plastic bags, placed in zip-lock plastic sacks and kept in a thermal bag at about ... trees) in an area As an example, at equal vegetation covers, a forest will show more PhA than a shrub or grass vegetation so that NDVI will be much higher in the former than in the latter case [7,...
... were applied and the required voltage measured The pulse height measured far away from the sample surface was used to define the basal resistance Then, the probe was approached towards an insulating ... has been created from the subtraction of frame A from frame J (Fig 1) Here green areas denote areas without any changes in height, red areas correspond to areas of increasing height and blue areas ... (E) Insets in (A) and (B) display a magnification of the area marked by the dashes with increased contrast, white scale bar indicates 3.5 μm Arrows mark different cell parts that changed during...
... vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 o vascular dilation was associated with an increased endothelial proliferation rate o in addition to the dilation, ... [14] In addition, MGD has adopted the Mouse Embryo Anatomy Nomenclature Database [15] and the Anatomical Dictionary for the Adult Mouse [16] for annotating data that include anatomical attributes, ... systematic nomenclature Mech Dev 1998, 74:111-120 Hayamizu TF, Magan M, Corradi JP, Kadin JA, Ringwald M: The Anatomical Dictionary for the Adult Mouse: atoolfor annotating and integrating data...
... other than final sales Among the measures that are often advocated as appropriate intermediate measures are attitudinal changes caused by advertising Those who advocate using an intermediate measure ... Investment-generating Locality Britain Canada CostaRica Ireland Jamaica Malaysia Scotland Singapore Thailand Promotionagency techniques used Investin Britain Bureau(IBB) InvestmentCanada CostaRicanInvestmentPromotion ... regional market Costa Rica and Jamaica, for example, both had preferential access to the United States market through the Caribbean Basin Initiative; Britain and Ireland both had preferential access...
... then transcribed for data analysis The data transcripts consisted of 15 pages for field notes and 50 pages for interviews 2.6 Data analysis 25 Once the researcher had obtained all the data transcripts ... research into how to overcome its barriers 1.3 Why team-teaching asa valuable means for professional development? The study of team-teaching asa viable alternative to traditional teaching asa ... teacher said: “ Other thing that was beneficial about it was that it was able to work with different teacher in the same classroom The class was easily controlled and there was time for us to...
... tham khảo Bachman, L.F., Fundamental considerations in language testing, Oxford: Oxford University Press, 1990 Bolton, S., Evaluation de la compétence communicative en langue étrangère, Traduit ... to assess Readers' Prior Knowledge, The Teaching Teacher, 40(7), 1987, p.646-650 Lussier, D., Evaluer les apprentissages dans une approche communicative, Paris: Nathan, 1992 Scallon, G., L'évaluation ... de l'allemand par Bertrand, Paris: Hatier, 1987 Carroll, J.B., The Psychology of language testing, In A Davis (Ed.), Language Testing Syposium, A psycholinguistic perspective, London: Oxford...
... molecules and atoms, giving the plasma the ability to act asa whole rather than asa bunch of atoms Usually, plasma is generated by increasing the gas temperature or electromagnetic excitation of gas ... irradiation has, however, limitations, such as possible surface damage and lack of straightforwardness for industrial applications [17] 3.4.2 Plasma Treatment Molecules of matter in gaseous form have ... industry has also led to the increasing popularity of the biocatalysis It has a great advantage of being a more sustainable process as it utilizes naturally-available enzymes to promote grafting...
... heritage and art forms, local festivals, road drives and activities for children As (1) asserted that it is important to measure consumer satisfaction applying as many destination attributes as ... their ways of living Aranmula is famous for its ‘metal mirror’ and boat race There are also institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school for ... s c o m [39]Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions of service quality in tourism – an Indian perspective”, Total Quality Management, Vol 20, No...