... injection, and other oxide and alkali halide compounds have also been tested as intermediate layer between the electrode and OSC to enhance charge injection [18 , 19 ] A thick encapsulation layer ... spin-coated and baked at 13 0ºC (hotplate, 15 min) in the glovebox The metal 38 cathode was evaporated at a base pressure < 10 –6 mbar to define 4.27-mm2 diodes through shadow mask, and capped with 13 0-nm-thick ... organic light-emitting devices Nature 440, p 908- 912 ( 2006) 25 Braun, S., W.R Salaneck, and M Fahlman, Energy level Alignment at Organic/Metal and Organic/Organic Interfaces Advanced Materials...
... Grant from the NIH Intramural AIDS Targeted Antiviral Program to K.S andby the Intramural Research Program of the NIH, NIAID References 10 11 12 13 14 15 16 17 18 Strebel K, Klimkait T, Martin ... primers 5' ATAAC TCGAG GTGGA ATTCA TGGCA TCTAC TTCGT ATGAC TATTGC and 3' AAGCT TGGTA CCTCA CTGCA GCAGA GCGCT GAGGC CCAGC AGCAC The resulting PCR product was cleaved with XhoI and KpnI and cloned into ... Spearman P: Viral protein U counteracts a human host cell restriction that inhibits HIV -1 particle production Proc Natl Acad Sci USA 2003, 10 0 :15 154 -15 159 Callahan MA, Handley MA, Lee YH, Talbot...
... were F1: 5’ GGT TTA AAC TTT ATT CTG ACT GTT CCC, R1: 5’ ACA CAA TTT AGT AAT AGC CAA AGT CAA C, F2: 5’ GTT GTT GTG AAG TAG AAA CTG ATT TCT AA, and R2: 5’ CTG GGG AGT GGG CCA Genomic DNA was applied ... gastric atrophy (GA) of Gab1 and the combinations of PTPN 11 and Gab1 genotypes among seropositive healthy controls Genotype Gab1 G/G G /A A /A G /A+ A /A Total PTPN11b Gab1 G /A+ A /A G/G G /A+ A /A G /A+ A /A ... essential component for ERK activation [13 -17 ] The activated SHP-2 is associated with Gab1 to mediate EGF-stimulated ERK2 activation, and Gab1 is the SHP-2 activator for the ERK MAP kinase pathway...
... infection Crit Care 2007, 11 :R122 Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto H, Iino S, Taniguchi N, Maruyama I: The ... rodent macrophages Scand J Immunol 2005, 61: 19 32 Park JS, Gamboni-Robertson F, He Q, Svetkauskaite D, Kim JY, Strassheim D, Sohn JW, Yamada S, Maruyama I, Banerjee A, Ishizaka A, Abraham E: High ... Frazier A, Yang H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J, Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ: HMG -1 as a late mediator of endotoxin lethality in...
... Shaffer A, Talley JJ, Masferrer JL, Seibert K, Isakson PC: Pharmacological analysis of cyclooxygenase -1 in inflammation Proc Natl Acad Sci USA 19 98, 95 :13 313 -13 318 Futaki N, Takahashi S, Yokoyama ... 19 97, 12 1:695-704 Page of (page number not for citation purposes) Journal of Inflammation 2009, 6:20 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Swierkosz TA, Mitchell JA, Warner ... with Image J1. 34 s (NIH) Prostaglandin E2 concentrations were estimated from a standard curve and calpain activity was indicated by the fluorescence increase per minute Data were analyzed by Student's...
... (5’-PO4CGAAGCTTCTTCTCTGCGTCAAATTCTGGATTCTCAAAAAATGGAATGGCGTTCTAACGCTGGTGGTTCTTT-3’, BAD inderlined) and AS5 (5’-PO4GCTTAGAACCACCAGCGTTAGAAC-GCCATTCCATTTTTTGAGAATCCAGAATTTGA-CGCAGAGAAGAAGCAA) which was ligated with ... 5’GGATGAGGATGCTTCTTCTCTGC-GTCAAATTCTGGATTCTCAAAAAATGGAATGG-CGTTC TAACGCTGGTGGTTCTTAACACATGGAATTCTGCAACAAC 3’; EcoRI site in italics) and used in a PCR fusion with F1 fragment using oligonucleotides containing respectively ... integrase J Biol Chem 19 98, 273: 3507 8- 3508 7 Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV -1 integrase J Biol Chem 19 97, 272 :16 196 -16 205 Page 10 of 10 31 Michel...
... Australia, Australia 500 0 4Discipline of Medicine, University of Adelaide, Royal Adelaide Hospital, Level Eleanor Harrald Building, North Terrace, Adelaide, South Australia, Australia 500 0 Page ... Terrace, Adelaide, South Australia, Australia 500 0 2Intensive Care Unit, Level 4, Emergency Services Building, Royal Adelaide Hospital, North Terrace, Adelaide, South Australia, Australia 500 0 3National ... Peptides 2005, 12 8: 11 7- 12 4 14 15 16 Nauck MA, Walberg J, Vethacke A, El-Ouaghlidi A, Senkal M, Holst JJ, Gallwitz B, Schmidt WE, Schmiegel W: Blood glucose control in healthy subject and patients receiving...
... 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢ Phi-C and Phi-W were complementary to each other Phi-C was labeled ... strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA ... single-strand DNA (ssDNA) and assimilation of ssDNA into homologous super-coiled duplex DNA J Biol Chem 276, 419 06– 419 12 10 Nara T, Hamada F, Namekawa S & Sakaguchi K (20 01) Strand exchange reaction...
... have used, and required him to meet at Rome the accusation brought against him by John Talaia, a duly elected patriarch of Alexandria, just as St Julius, a hundred and forty years before, had ... went to Gaul, conquered Narbonne, Toulouse, and Bordeaux, and afterwards Barcelona His half-brother Wallia, after reducing the Alans and driving back the Sueves and Vandals, planted his seat in ... coast, and Dalmatia, and these lands he was able to protect from outward attack and inward disturbance He made Ravenna his seat of government He did not assume the title of king at Rome He maintained...
... X 813 23 and U5 019 4 The catalytic Asp44 and His264 are indicated by asterisks to activate the material, as previously described [15 ] However, all attempts so far to associate this material have failed ... onto a Sepharose CL-4B column and chromatography was performed as described in Materials and methods Enzyme activity was analysed by the standard assay and the immunoreactivity was detected by ... 5¢-GGTCAC GACTGATGGGAAAC-3¢ and 5¢-CCATGAGCTCCTC CACTGGT-3¢ and the RT-PCR kit (PerkinElmer, Boston, MA, USA), except that Advantage polymerase (Clontech, Palo Alto, CA, USA) was used The amplified...
... San Francisco, CA Jones MC (2007) Therapies for diabetes: pramlintide and exenatide Am Fam Physician 75, 18 31 18 35 Supporting information The following supplementary material is available: Table ... is a proline (aggregation breaker) Several other parameters are calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation profile above the HST, the total area ... the authors of waltz FEBS Journal 278 (2 011 ) 2428–2435 ª 2 011 The Author Journal compilation ª 2 011 FEBS S J Hamodrakas Software for controlling formation of bacterial inclusion bodies estimated...
... S.M., Nagahama, Y & Miller, W.L (19 93) Steroid 17 alpha-hydroxylase and17 , 20-lyase activities of P450c17: contributions of serine106 and P 450 reductase Endocrinology 13 2, 2498– 2506 Yanagibashi, ... product was confirmed by cocrystallization with commercial steroid (data not shown) Assessment of the 16 -ene-synthase, 1 7a- hydroxylase and17 , 20-lyase activities of human and porcine P450c17 In order ... observed at a cytb5/ P450c17 ratio of : (0.25 lg cytb5/0 .1 lg P450c17) while the optimal stimulation is observed at a ratio of 12 : (1 lg of cytb5/0 .1 lg of P450c17) Transfections and enzymatic assays...