measuring the activity of leucine rich repeat kinase 2 a kinase involved in parkinson s disease
Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx
... CGCTGCTCCCACATTGGCTAAG TGTGCATGGGTGAAGGGAGAGC 15 RAB25 21 -33 TGATCGGCGAATCAGGTGTGG CAACATCACAGTGCGGGTGGAG 16 S1 0 0A2 22 -27 GCAGCCTGGATGAGAACAGTGACC CAGCCCTGGAAGAAGTCATTGCAC 17 S1 00P 18- 32 GTCTGAATCTAGCACCATGACG ... GTCTGAATCTAGCACCATGACG GGAAGCCTGGTAGCTCCTTC 18 SLCO 4A1 22 - 32 TCCATCTGGCTCCTGCTGAAGAAC GCTTCTGAGGCACTCAGGCTGAAC 19 20 STMN1 TGM2 21 -25 21 -36 AAAGAACTGGAGAAGCGTGCCTCAG CTGGTCACTAACCAACAAGGTTG CTGAATTTCCTCCAGGGAAAGATCC ... analyzed 48 SQ clinical tissue samples and classified them into two subclasses Subclass A genes were related to processes such as cell proliferation and cell cycle progression, while subclass...
- 12
- 520
- 0
Tài liệu Báo cáo khoa học: A differential scanning calorimetry study of tetracycline repressor pptx
... heating of the sample immediately after fast cooling from the rst scan The excess molar heat capacity was calculated using the molecular mass of the Tet repressor of 46 708 Da and the partial specic ... A small decrease in denaturation enthalpy was observed on a rise in scan rate for the repressor in the absence of Tc, whereas for the ligated protein, a slight increase was noted The Tmax is the ... Kặmin)1: K N2 Tc2 ! 2Tc ỵ U2 This two-state model assumes that the total excess heat capacity is a sum of n independent two-state thermal transitions As can be seen in Fig 5, tting of onetransition...
- 10
- 493
- 1
Applications of Calorimetry in a Wide Context - Differential Scanning Calorimetry, Isothermal Titration Calorimetry and Microcalorimetry docx
... properties of materials are strongly related to the size of nanocrystals essentially when the radius of nanocrystals is smaller than 10 nm Hence, an important task of thermal analyses is to find the size-dependent ... important attribute that influences viscoelastic properties of PLA The increase of the ambient temperature above Tg of PLA causes the sharp loss of its stiffness The Tg values of PLA are influenced ... case Tm was determined as the peak temperature of the melting peak) and the crystallinity (see Figure and Table 4) As an adequate indicator of the crystallinity was chosen the specific heat of...
- 484
- 3,011
- 0
Báo cáo khoa học: Purification and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf
... examined by SDS/PAGE [15] Assay of human PKIb activity The activity of purified human PKIb was assayed by the inhibition of the catalytic subunit of cAPK in a 50 lL reaction containing 0.5 units of purified ... (NCBI) analysis (Genbank accession number AF 225 513) This gene contains an open reading frame of 23 7 nucleotides and a putative polyadenylation signal ATTAAA (1018– 1 023 ) and poly (A) tail (Fig 1) The ... 24 3.4 1. 52 1. 52 1 .2 Table According to the activity assay, the activity was retained above 95% (data not shown) and the recovery is 24 % during the heat-treatment It implied that PKIb was a thermostable...
- 6
- 531
- 0
Báo cáo Y học: Differential scanning calorimetric study of myosin subfragment 1 with tryptic cleavage at the N-terminal region of the heavy chain pdf
... strongly attached state (in the presence of ADP) [26 ] and weakly attached state (in the presence of ATP analogs) [27 ] As the N-terminal region is located spatially far from actin-binding sites in the ... Bradford protein assay [ 32] using undigested S1 as standard K+-EDTA-ATPase activities of S1 , t -S1 , and Nt -S1 were determined by measuring the released Pi Actin was prepared from rabbit skeletal-muscle ... curves obtained in the absence of F-actin under the same conditions Strong binding of t -S1 to F-actin in the presence of ADP increases the thermal stability of t -S1 substantially by shifting whole...
- 11
- 432
- 0
selfridge, arnold, warnick. teaching electromagnetic field theory using differential forms
... similar to Gauss 's laws for the electric and magnetic elds The close relationship between the two sets of laws becomes clearer S A Ampere 's and Faraday 's Laws Faraday 's and Ampere 's laws equate the ... Other eld and source quantities are assigned units according to this same convention A disadvantage of Deschamps' system is that it implies in a sense that the metric of space carries units Alternative ... y-axis and the surfaces of dz are perpendicular to the z axis A linear combination of these di erentials has surfaces that are skew to the coordinate axes The coe cients of a 1-form determine the spacing...
- 37
- 372
- 0
Differential scanning calorimetrycalorimetry
... : Aluminium, platinum, stainless steel pans individual heaters Sensors: Pt resistance thermocouples Separate sensors and heaters for the sample and reference sample pan reference pan inert gas ... of heat ( 12. 4 kJ/hr) EYP 20 06 Basic Principles of Thermal Analysis Modern instrumentation used for thermal analysis usually consists of four parts: sample/sample holder sensors to detect/measure ... “reaction” is kept constant whilst the energy change is measured Thermogravimetric Analysis (TGA) • the change in mass of a sample on heating is measured EYP 20 06 Thermogravimetric Analysis (TGA)...
- 41
- 240
- 0
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx
... Cycle assay (Guava Technologies) Cells were analysed on the Guava EasyCyte and the data was analysed using Modfit LT software (Verity) Statistical analysis IC50 values were calculated using CalcuSyn ... effects of dasatinib, a multi-targeted tyrosine kinase inhibitor, in human melanoma cell lines [6] In a previous study in breast cancer cell lines, sensitivity to dasatinib was characterised as greater ... Invasion and migration assays were performed as previously described [17], using × 105 cells in matrigel-coated 24 -well invasion inserts for invasion assays and uncoated inserts for migration assays...
- 11
- 476
- 0
Báo cáo hóa học: " Temperature-Dependent Site Control of InAs/GaAs (001) Quantum Dots Using a Scanning Tunneling " pptx
... we started supplying In flux again The amount of InAs supply was estimated at 0. 02 ML in every scan After supplying additional 0. 02 ML of InAs, spontaneously, mobile In atoms congregated to this ... site-controlled InAs nano dots were fabricated At 430°C, InAs nano dots were also fabricated However, these dots were remained at least 40 s and collapsed less than 1000 s Then, we fabricated InAs nano dots ... bias’ The time of applying voltage was 0.0 52 s, and a voltage value was increased every 0.00 026 s by a step function, and then observed the surface structure transitions Results and Discussion...
- 5
- 356
- 0
Báo cáo vật lý: "EXOTHERMIC TRANSITIONS ON COOLING OF GELATINIZED NATIVE RICE STARCH STUDIED BY DIFFERENTIAL SCANNING CALORIMETRY" doc
... enthalpies (ΔH) 2. 3 Statistical Analysis The data was statistically analyzed by one-way ANOVA (for comparing more than two means), using SPSS Version 12. 0 For Windows (SPSS Inc., Chicago, Illinois) ... not appear to alter the main gelatinization temperature of rice Thermal Transitions on Cooling of Rice Starch 40 starch Similar observation has been found in other cereal and cassava starches as ... basis.3–5 It has been shown that in rice starches, the internal granular lipids are mainly free fatty acids and lysophospholipids.6 The lipids exist as amylose-lipid inclusion complexes in native...
- 11
- 408
- 0
Báo cáo y học: " Local treatment with the selective IκB kinase β inhibitor NEMO-binding domain peptide ameliorates synovial inflammation" pot
... were analyzed for statistical significance (GraphPad, InStat, version 2. 02; GraphPad Software, Inc., San Diego, CA, USA), using the Student 's t test or MannWhitney U test A p value < 0.05 was taken ... synovial inflammation by performing immunohistochemical stainings on sections from paraffin-embedded rat ankle joints Digital image analysis of comparable locations in the synovial tissue showed a ... draft the manuscript NH assisted in the animal studies and cell culture and performed immunohistochemical stainings and digital image analysis MJM and SG participated in the design of the study...
- 9
- 286
- 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 3 52 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 26 4 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA ... 12, and 14 Hydroxyproline release was assayed as a measure of collagen degradation, and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [20 ] Collagenase and inhibitor ... together, these data suggest that serine proteinases are involved in the activation cascades of the pro-collagenases and pro-gelatinases that result in cartilage resorption [21 ,49] Because cartilage...
- 12
- 526
- 0
Báo cáo khoa học: " The c-Met receptor tyrosine kinase inhibitor MP470 radiosensitizes glioblastoma cells" ppt
... H, et al.: A novel tyrosine kinase switch is a mechanism of imatinib resistance in gastrointestinal stromal tumors Oncogene 20 07, 26 :3909-3919 Parsa AT, Waldron JS, Panner A, Crane CA, Parney ... involving signaling through phosphatidylinositol 3' kinase Oncogene 20 00, 19 :22 12- 222 3 Danilkovitch-Miagkova A, Zbar B: Dysregulation of Met receptor tyrosine kinase activity in invasive tumors J ... receptor associates with phosphatidylinositol 3 -kinase J Biol Chem 1991, 26 6 :22 087 -22 090 Beurel E, Jope RS: The paradoxical pro- and anti-apoptotic actions of GSK3 in the intrinsic and extrinsic apoptosis...
- 10
- 217
- 0
Báo cáo y học: "Reliability of capturing foot parameters using digital scanning and the neutral suspension casting technique" ppt
... the three casting techniques Burns et al [7] examined the intra-rater reliability of neutral suspension casting in pes cavus feet The results indicated neutral suspension casting technique had ... between measurements repeated over time Only variations greater than the SRD can be considered as true variation The SRD has the same measurement units of the investigated variable ‘’Smallest real difference’’ ... consistency definition [8] Standard error of the measurement (SEM) calculations were undertaken to assess the difference between the actual measured score across the casts and digital images and...
- 7
- 341
- 0
báo cáo khoa học: "ABT-869, a promising multi-targeted tyrosine kinase inhibitor: from bench to bedside" doc
... RTK inhibitor, is active against all VEGFRs and PDGFR families, but minimally active against unrelated RTKs and cytosolic tyrosine kinases and serine/threonine kinases [18] The goals of this article ... effectors such as the PI3K/AKT pathway, RAS/MAPK pathway, and the STAT pathway, mainly STAT5 (Figure 6) Oncogenic protein kinase PIM1 also is up-regulated by FLT3-ITD These rampant signaling pathways ... gain -of- function and consecutive activation of the kinases in general The fms-like tyrosine kinase (FLT3) is a class III RTK family and shares strong structural similarity with other family members including...
- 13
- 400
- 0
Báo cáo y học: "Inhibitory effects of ZSTK474, a novel phosphoinositide 3-kinase inhibitor, on osteoclasts and collagen-induced arthritis in mice" pot
... levels were measured using a mouse TRAP™ Assay (Immunodiagnostic System Ltd) Statistical analysis Statistical significance of differences was assessed by oneway analysis of variance (ANOVA) followed ... safranin O to assess hyperplasia of synovial tissue, infiltration of leukocytes, and destruction of cartilage Each parameter was graded separately and assigned a severity score as follows: grade ... Nakamura I, Takahashi N, Sasaki T, Tanaka S, Udagawa N, Murakami H, Kimura K, Kabuyama Y, Kurokawa T, Suda T: Wortmannin, a specific inhibitor of phosphatidylinositol-3 kinase, blocks osteoclastic bone...
- 11
- 243
- 0
Báo cáo y học: " Inhalation of the Rho-kinase inhibitor Y-27632 reverses allergen-induced airway hyperresponsiveness after the early and late asthmatic reaction" pps
... effects only by increasing [Ca2+]i, but also by increasing the sensitivity of the contractile apparatus to Ca2+ One of the main pathways involved in this Ca2+-sensitization is the RhoA/Rho -kinase ... LAR means ± s. e.mean of PGF2α (B) Data expressed as the Effectiveness of saline and Y -27 6 32 inhalations to reduce basal airway responsiveness and airway (hyper)responsiveness after the EAR and ... basal airway responsiveness in the absence of the Rho -kinase inhibitor (P < 0.05) As for histamine, Y -27 6 32 inhalation fully reversed the AHR to PGF2α after the LAR to the basal responsiveness...
- 7
- 217
- 0
Báo cáo sinh học: "Characteristics of predictor sets found using differential prioritization" docx
... dataset Separation of classes for a 6-class OVA-based toy dataset Separation of classes by predictor sets obtained Figure Separation of classes for a 4-class OVA-based toy dataset Separation of ... maximum and minimum values of x0,k across k in Table 2, we can say with certainty that there is an imbalance among classes in terms of class means especially in datasets containing more than classes ... distinguishes samples from one class of the pair of classes against samples from the other class of the pair of classes As implied by its name, this model represents the 1-vs.-1 paradigm as opposed...
- 21
- 222
- 0
Báo cáo y học: "The Bruton tyrosine kinase inhibitor PCI-32765 ameliorates autoimmune arthritis by inhibition of multiple effector cells" ppsx
... hours after the challenge, the animals were euthanized, and skin tissue was assessed for edema and inflammation by measuring dye extravasation into the surrounding tissue Punch biopsies of the injections ... with arrowheads; asterisks show carpal bones in panels 1, and R, radius; U, ulna; MC, metacarpal In panel 5, and asterisks show severe inflammation, and arrows show loss and necrosis of cartilage ... cells PCI- 327 65 dose-dependently ameliorates disease in anticollagen antibody induced arthritis, reverse passive anaphylaxis assay, and passive cutaneous anaphylaxis models We have shown that...
- 15
- 334
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008