maximum period of one month except where there have been significant fluctuations in this rate during the period

Báo cáo toán học: "Role of One N-linked Oligosaccharide Chain on Canine Herpesvirus gD in Its Biological Activity" ppt

Báo cáo toán học: "Role of One N-linked Oligosaccharide Chain on Canine Herpesvirus gD in Its Biological Activity" ppt

Ngày tải lên : 07/08/2014, 11:21
... ACTATTAATAAAACTATTAA, flanking this mutated region, existed in the gD gene of YP2 strain and other strains including the parent strain of YP11mu strain (Fig 1B) Therefore, this mutation of gD (YP11mu) might ... YP11mu strains grew well in MDCK cells, and that HA activity of lysates from YP11mu strain-infected cells were similar to those of other several CHV strains including YP2 strain In gDs of HSV-1 ... characteristics of the recombinant virus in vitro and in vivo ACKNOWLEDGEMENTS This work was supported in part by grants from the Ministry of Education, Science, Sports and Culture, from the Ministry of Agriculture,...
  • 6
  • 175
  • 0
Occurrence of Polyhydroxyalkanoate as Temporal Carbon Storage Material in Activated Sludge during The Removal of Organic Pollutants

Occurrence of Polyhydroxyalkanoate as Temporal Carbon Storage Material in Activated Sludge during The Removal of Organic Pollutants

Ngày tải lên : 05/09/2013, 09:38
... obtained for both of the SBRs In the SBR reactors, the substrate was supplied intermittently, and thus the gradients of substrate concentration in addition to the oxygen limitation might have ... only in the anaerobic zone of the studied reactors but also in the microaerophilic zone of MO reactor These results support that temporal carbon storage is one of the important processes for the ... essentially have a configuration as shown in Figure In Figure 1, symbols, Q and r, indicate the flow rate and the recycle ratio of activated sludge And, subscripts, In, I, II, R, and Eff, indicate the influents,...
  • 7
  • 490
  • 0
Tài liệu Báo cáo khoa học: Minor capsid proteins of mouse polyomavirus are inducers of apoptosis when produced individually but are only moderate contributors to cell death during the late phase of viral infection ppt

Tài liệu Báo cáo khoa học: Minor capsid proteins of mouse polyomavirus are inducers of apoptosis when produced individually but are only moderate contributors to cell death during the late phase of viral infection ppt

Ngày tải lên : 16/02/2014, 09:20
... Discussion In the present work, the cytotoxic properties of the minor structural proteins (VP2 and VP3) of the MPyV were studied in the absence of other virus components as well as during the late ... toxicity of the minor proteins is controlled during the infectious cycle and that other viral components and ⁄ or cell responses are involved in cell death during the late phase of viral infection ... capsid proteins are not the sole or even the main inducers of apoptosis in the infection process and are dispensable for cell death During infection, most of the minor capsid proteins become integral...
  • 14
  • 539
  • 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

Ngày tải lên : 08/03/2014, 23:20
... energy savings in the form of fuel and machinery, these savings were largely offset by increased energy expended on pesticides and N fertilizers In a study conducted in the Parkland region of the Canadian ... major limitation of their use, by allowing efficient use of often marginal land they play a critical role in global food security Furthermore, the methane emissions of ruminants consuming forages ... generate 77% of the global warming emissions, 17% of the ozone-depleting emissions, and 96% of the acidifying emissions [sulfur dioxide] associated with current national production of these crops...
  • 41
  • 524
  • 1
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Ngày tải lên : 17/03/2014, 10:20
... order, and the rate constants were obtained by nonlinear least-squares fitting to the absorbance data The numbering of the amino acid residues in each lysozyme protein follows that of the Protein Data ... observed in all peptides containing tyrosine 23 or 53 but not in peptides containing tyrosine 20 alone According to these results, tyrosines 23 and 53 could be involved in the dimerizations whereas ... fragmentation The N-terminal sequences of the first 10 amino acids of the longest moieties are identical to that of the native proteins MS of HEWL gave a small peak corresponding to 11 286 Da and another one...
  • 7
  • 474
  • 0
Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

Ngày tải lên : 31/03/2014, 21:21
... inhibited by PMLA contained in the extracts The inhibitory activity during the cell cycle The inhibitory activity during the cell cycle was measured in the presence of 0.4 U of (added) purified DNA ... to a minimum in inhibitory activity and a maximum in the residual polymerase activity (63% of the reference activity) After h following mitosis and during the remainder of the cell cycle, the polymerase ... at the end of S-phase This would explain the end of the activity period of DNA polymerases Instead of assuming a neutralization of the inhibitory activity, the DNA polymerases could bind effectors,...
  • 6
  • 347
  • 0
Báo cáo y học: " The testis and epididymis are productively infected by SIV and SHIV in juvenile macaques during the post-acute stage of infection" pot

Báo cáo y học: " The testis and epididymis are productively infected by SIV and SHIV in juvenile macaques during the post-acute stage of infection" pot

Ngày tải lên : 13/08/2014, 09:20
... in the interstitial space of the testis, between the seminiferous tubules [4] CD4+ T cells in the testis of HIV-1 infected men are the major cells infected by the virus in this tissue according ... number of cells) and up to 50 % of total germ cells infected in some of the SHIV infected macaques (6 cells infected in one tubule in the example shown) (ii) Individual staining and merged images of ... macrophages and CD4+ T cells of the testis are a target for infection in the early stages of HIV-1 infection or whether this is a feature only of the late stages of the disease In the epididymis, CD4+...
  • 12
  • 378
  • 0
Báo cáo y học: "Human embryonal epithelial cells of the developing small intestinal crypts can express the Hodgkin-cell associated antigen Ki-1 (CD30) in spontaneous abortions during the first trimester of gestation" ppsx

Báo cáo y học: "Human embryonal epithelial cells of the developing small intestinal crypts can express the Hodgkin-cell associated antigen Ki-1 (CD30) in spontaneous abortions during the first trimester of gestation" ppsx

Ngày tải lên : 13/08/2014, 22:22
... taking into account that the ratio of the area of the intestinal stroma to the area of surface epithelium Page of (page number not for citation purposes) Theoretical Biology and Medical Modelling ... enteroendocrine) grow throughout life Third, CD30 expression in the epithelial cells of the developing intestinal crypts is induced by progesterone This is a novel mechanism of CD30 induction, distinct ... cells within the intestine in all settings examined (Fig 1), with percentages varying from 3.2 to 3.9 (mean ± sd = 3.61 ± 0.16) In the neighbouring intestinal stroma a slight cellular infiltration...
  • 6
  • 238
  • 0
Báo cáo y học: "Changes in gene expression during the development of mammary tumors in MMTV-Wnt-1 transgenic mice" ppt

Báo cáo y học: "Changes in gene expression during the development of mammary tumors in MMTV-Wnt-1 transgenic mice" ppt

Ngày tải lên : 14/08/2014, 14:22
... contain the 8700 Incyte GEM1 clone set and the mammary 6000 clone set; a total of 1,444 clones not map to a Unigene cluster ID, whereas the rest of the clones map to 10,062 unique genes as defined ... linkage hierarchical clustering analysis (Figure 1), suggesting that the global expression patterns of these two sets of tumors differ significantly This finding extends previous reports of significant ... described in the preceding section suggest that initiating oncogenes strongly influence gene expression in the tumors arising in these two Genome Biology 2005, 6:R84 information MMTV-Wnt-1-induced...
  • 13
  • 280
  • 0
use of artemia biomass and gut weed meal as protein source in practical diets for the black tiger shrimp (penaeus monodon)

use of artemia biomass and gut weed meal as protein source in practical diets for the black tiger shrimp (penaeus monodon)

Ngày tải lên : 21/09/2015, 13:55
... the exception of methionine and arginine, others even indispensable amino acids were detected in the monthly samples, having similar values during the period from July to December The most common ... threonine, tryptophan, histidine, osoleusine, leusine, valine, phenylanine The ratio of amino acids in foods as close to the ratio of amino acids in the shrimp body which resulted in better growth (Wouter ... suggested that the optimum range of pH 6.8 to 8.7 should be maintained for maximum shrimp growth and production Alkalinity is the buffering capacity of the pond water The higher the alkalinity, the better...
  • 37
  • 245
  • 0
Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot

Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot

Ngày tải lên : 11/08/2014, 16:22
... density than that of the SEQ The economy in Queensland has increased more rapidly than that of other areas in Australia since 1992, except for the financial year 1995-1996 [19] Mining, financial services ... [17,24] The SaTScan has the maximum limit in controlling the radius and population of clusters; therefore LGAs in the far north mentioned above, covering a large proportion of the whole study area, ... analyses and interpretation of the results All the authors contributed to the preparation of the final manuscript and approved the submission Competing interests The authors declare that they have no...
  • 10
  • 356
  • 0
Báo cáo y học: " The impact of critical care outreach: is there one" ppt

Báo cáo y học: " The impact of critical care outreach: is there one" ppt

Ngày tải lên : 13/08/2014, 10:20
... Cuthbertson So where does this leave us with regard to future of CCOS in the United Kingdom and beyond? The continued inability of studies to demonstrate the efficacy of CCOS and a complete lack of evidence ... or cutoff points due to the lack of evidence of accuracy for these scores in clinical practice [9] Despite the lack of evidence, the Institute of Healthcare Improvement recommends ‘deploying rapid ... CCOS now disinvest and spend these resources in more effective ways? It is time to answer these difficult questions! Competing interests The author declares that they have no competing interests...
  • 2
  • 265
  • 0
REVISION OF ONE PERIOD TEST 4

REVISION OF ONE PERIOD TEST 4

Ngày tải lên : 05/06/2015, 15:00
... Ø IV Circle the incorrect underlined part in the following sentences below: The book written 100 years ago has now been considered one of the greatest work of human kind A B C D The coachman ... had to put his car key in the pocket so as to not drop it A B C D V Transform the following into cleft sentences, focusing on the underlined part: I meet them on a cold rainy December day ………………………………………………………………………………… ... ………………………………………………………………………………… I booked the table at the finest restaurant in town ……………………………………………………………………………… VI Complete each cleft sentence in the passive, emphasizing the underlined part, in such a way that...
  • 2
  • 784
  • 2
Báo cáo y học: " Post-traumatic glioma: Report of one case and review of the literature"

Báo cáo y học: " Post-traumatic glioma: Report of one case and review of the literature"

Ngày tải lên : 25/10/2012, 11:48
... (3) the location of the impact and the occurrence of the tumor corresponded exactly one to the other; and (4) there was a more than one year interval between trauma and the appearance of the ... other There should be a time interval between trauma and the appearance of the tumor of at least year, a longer latent period increasing the likelihood of a causal relationship The presence of ... Experimental data have shown that trauma can act as a cocarcinogen in the presence of an initiating carcinogen It was hypothesized that cells damaged by the initiating carcinogen proliferated as a natural...
  • 3
  • 550
  • 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Ngày tải lên : 07/11/2012, 14:44
... ideational meaning but the textual meaning An investigation into the role of metaphor in description of emotion in poetic discourse 13 There is the third kind of meaning called interpersonal meaning which ... refers to the consideration of meaning in an incongruent way at the level of the organization of the discourse The most congruent form of joining two ideas is An investigation into the role of metaphor ... different way of construing the world Second, it can increase the information load of the nominal group by nominalizing the dynamic process and putting several epithets before the head of the nominal...
  • 53
  • 1K
  • 3
Tài liệu Tiếng Anh lớp 1, 2 - Lesson twenty-one (Bài 21) WHERE...? WHEN...? pptx

Tài liệu Tiếng Anh lớp 1, 2 - Lesson twenty-one (Bài 21) WHERE...? WHEN...? pptx

Ngày tải lên : 21/01/2014, 15:20
... evening - When is it ? - In the morning Bước 4: Đọc câu sau dịch sang tiếng Việt: Where are you? - I am at the school Where is he? - He is at the office Where is she? - She is at home Where ... in the afternoon When is it dark? - It is dark in the evening When is it sunny? - It is sunny in the morning Bước 5: Dịch sang tiếng Anh Bạn sinh quán đâu? - Tớ sinh quán Việt Nam Bạn trai sinh ... Where are they? - They are in - Where are you? - We are - Where it is from? - It is from - Where am I? - You are - Where are we from? - We are from - When is it ? - In the...
  • 8
  • 318
  • 1
Tài liệu Why Should I Stay?...or How to Engage Hearts and Minds of our People in this Chaotic Period pptx

Tài liệu Why Should I Stay?...or How to Engage Hearts and Minds of our People in this Chaotic Period pptx

Ngày tải lên : 25/01/2014, 00:20
... In this transition period, we have a blank sheet of paper They can create the future They are listened to They can come with ideas/input that will influence the company’s future and their ... explicit It is working in Asda and in Boots In net, We want to have people excited about winning and delighted about what is in it for them They will then believe they should stay working for P&G because ... : Have a training programme This is often why people joined P&G in the first place and this is currently perceived as missing Have a plan for each team and each function focused towards building...
  • 3
  • 478
  • 0
Tài liệu The Zen of BloggingHunter Nuttall© 2008 Hunter Nuttall . com1.What is the Sound of One Hand pptx

Tài liệu The Zen of BloggingHunter Nuttall© 2008 Hunter Nuttall . com1.What is the Sound of One Hand pptx

Ngày tải lên : 14/02/2014, 04:20
... will find answers," the old man said "One is within yourself The other is in these blogs For now, you have no answers within yourself, so we must start by observing these blogs For the rest of the ... Acknowledgements This ebook was heavily influenced by The Zen of Juggling by Dave Finnigan Additional inspiration came from The Matrix by The Wachowski Brothers, The Lord of the Rings by J R R Tolkien, The ... domain name," the old man said "While the words don't make sense, they have a nice ring to them They roll off the tongue and flow with the blog." "I see And what about this one? This one is long,...
  • 23
  • 584
  • 0