mary is said that she is a good worker b mary is said to be a good worker

Tài liệu ôn tập phụ đạo và ôn thi tốt nghiệp khối 12 môn tiếng anh (lý t huyết + bài tập)

Ngày tải lên : 17/07/2014, 09:30

... A Mary is said that she is a good worker B Mary is said to be a good worker C It is said to be a good worker D Mary is said that to be a good worker 31: People think that he is living abroad A ... a good worker A Mary is said that she is a good worker B Mary is said to be a good worker C It is said to be a good worker D Mary is said that to be a good worker 12 The castle built in the ... THE BEST ANSWERS Dont be late again! she said A She promised me not to be late again B She said me not to be late agai C She asked me not to be late again D She agreed not to be late again ...

112
1.4K
6

Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot

Ngày tải lên : 10/08/2014, 09:20

... Aida R, Kudo T, Akiyama M, Doi M, Hayasaka N, Nakahata N, Mistlberger RE, Okamura H, Shibata S: The dorsomedial hypothalamic nucleus is not necessary for food-anticipatory circadian rhythms of behavior, ... oscillator, which Fuller et al claim to have disabled by Bmal1 knockout, and Gooley et al by DMH-ablation [11] According to Fuller et al, the failure of other labs to confirm their results is because ... meal omission day after day 21 sistencies raise questions about the reliability of the data analysis procedures used in the study 1c Data misalignment in Fuller et al is also indicated by mismatches...

13
349
0

Báo cáo khoa học: "Use of prophylactic fluconazole in a neonatal intensive care unit: efficacy is similar to that described in adult high-risk surgical patients" ppsx

Ngày tải lên : 12/08/2014, 23:21

1
259
0

It is said that he is said to , v v và supposed to (1)

Ngày tải lên : 14/01/2016, 16:31

... supposed to be very good (= It is said to be very good; people say that it’s very good) (Chúng ta xem phim Người ta nói phim hay lắm) - He is supposed to have stolen $60 (=He is said to have stolen ... is said that / He is said to , v.v Supposed to = The strike is expected to begin tomorrow (Người ta cho đình công b t đầu vào ngày mai) - It is alleged to have stolen $60 = He is alleged that ... is said that / He is said to , v.v Supposed to - The train was supposed to arrive at 11.30 but it was 40 minutes late (The train should have arrived at 11.30 according to the timetable) (Theo...

3
513
0

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Ngày tải lên : 19/02/2014, 17:20

... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... uvsq.fr/Database.html)] To date, biochemical characterization of TNSALP mutant proteins have been limited to a small number of cases Nevertheless, some missense mutations, in particular associated ... C (PI-PLC) from Funakoshi Co (Tokyo, Japan); Triton X-114 from Nacalai Tesque, Inc (Kyoto, Japan) Antiserum against recombinant human TNSALP was raised in rabbits as described previously [21]...

14
445
0

Tài liệu She is used to getting up late in cold weather pot

Ngày tải lên : 26/02/2014, 00:20

... *She is used to getting up late in cold weather Hình thức ngữ pháp : Cấu trúc câu "to be used to + V-ing " (Thói quen tại) Chúng ta quan sát câu sau Các b n di chuột vào từ để biết thể ... (Các b n kích chuột lần vào từ để biết thêm chi tiết từ đó) She is used to getting up late in cold weather 2 Các b n di chuột vào cụm từ để biết chức cụm câu: She is used to getting up late in ... used to getting up late” - quen với việc dậy trễ Đây động từ (verb) câu Trong is used to trợ động từ (auxiliary) “getting up” động từ câu (main verb) Cấu trúc câu to be used to + V-ing” diễn...

5
703
0

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Ngày tải lên : 07/03/2014, 09:20

... present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the SaPPase (Rantanen, unpublished), and superposition ... stress to activate a bacterial transcription factor Genes Dev 10, 2265– 2275 Adler E, Donella-Deana A, Arigoni F, Pinna LA & Stragler P (1997) Structural relationship between a bacterial developmental ... ions and an activated bridging water molecule with a pKa of 7.5 [11] to achieve catalysis, a common feature in hydrolytic metalloenzymes [12] One residue that appears to take part in catalysis...

10
542
0

Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

Ngày tải lên : 07/03/2014, 22:20

... instance? In this paper, we address this question by systematically training the graph-based REG algorithm on a number of “semantically transparent” data sets of various sizes and evaluating on a held-out ... Di Fabbrizio, Amanda Stent, and Srinivas Bangalore 2008 Trainable speaker-based referring expression generation In Twelfth Conference on Computational Natural Language Learning (CoNLL2008), pages ... instances, acceptable attribute selection results can be achieved; that is, results that not significantly differ from those obtained using the entire training set This is good news, because...

5
355
0

Cách sử dụng (Something) is down to (a number of something) pdf

Ngày tải lên : 10/03/2014, 11:20

... down to half a bag of rice” = “chúng n a bao gạo” Thông thường b n nói số lượng vật/ đồ vật b giảm, b n liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ... phận b n b sa thải Và có b n, sếp b n nhân viên B n nói chuyện với b n tình “We’re down to only people now” (something) is down to (a number of something) Khi có nhiều từng, b n dùng cụm “down to ” ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty b n v a gặp phải chút...

6
702
2

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20

... ﬂexible N-terminal moiety of Ure2p, which is critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher afﬁnity a conformational state ... light and heavy precursor masses for cross-linked candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually 10 Acknowledgements 11 We are ... Ssa1p but not by Ssa2p Mol Cell Biol 22, 3590–3598 Roberts BT, Moriyama H & Wickner RB (2004) [URE3] prion propagation is abolished by a mutation of the primary cytosolic Hsp70 of budding yeast...

12
510
0

Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx

Ngày tải lên : 15/03/2014, 20:20

... fiscal policy is sharper when measured on a calendar year basis because most of the policy changes are scheduled to take effect at the beginning of calendar year The Affordable Care Act comprises ... fiscal restraint scheduled to occur The agency analyzed an alternative fiscal scenario that reflects a combination of possible changes to current law, including changes that would maintain major ... year 2013 by more than half as much as removing all fiscal restraint, but they would change GDP growth in calendar year 2013 by less than half as much as removing all fiscal restraint That disparity...

10
538
0

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Ngày tải lên : 23/03/2014, 07:20

... plants [Raphanus sativus (radish), Brassica rapa (turnip), Brassica rapa L var glabra Regel (Chinese cabbage) and Brassica oleracea var italica (broccoli)] were purchased from a market Puriﬁcation ... into a PCaP1G 2A mutant (Fig 5) Thus, we conclude that PCaP1 is myristoylated at Gly2 and that cotranslational myristoylation anchors the protein to the membrane N-myristoylation is catalysed by ... var glabra; lanes and 10, B oleracea var italica The amount of protein applied was lg for A thaliana and 40 lg for the other plants 43 kDa) and Brassica oleracea var italica (broccoli, 41 kDa)...

16
424
0

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery ﬁbroblasts A role for phosphoinositide 3-kinase pot

Ngày tải lên : 24/03/2014, 03:21

... may be an atypical PAR2 that is not activated by existing classic PAR2 peptides To date, no bovine PAR sequences have been published and analysis of cleavage sites on these receptors may reveal ... Vector Laboratories), followed by treatment with avidin–horse radish peroxidase (Vectastain ABC kit, Vector Laboratories) and diaminobenzidine (DAB kit, Vector Laboratories) Following immunostaining, ... data suggest that PAR3 does not mediate signal transduction directly but instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate PAR1,...

10
437
0

She is going to go on business at the end of June potx

Ngày tải lên : 02/04/2014, 21:21

... chia d a theo chủ ngữ “going to viết tắt “gonna” văn nói Nếu muốn chia dạng phủ định, ta thêm “not” vào sau động từ to be - She is going to – cô Trong câu chủ ngữ she nên động từ to be ... to be + going to + V –nguyên thể” – làm Cấu trúc dùng để đến kế hoạch , dự tính, định thông qua Hành động chắn xảy tương lai (thường gọi tương lai gần) Ta cần lưu ý động từ to be (am, is, are)” ... *She is going to go on business at the end of June Hình thức ngữ pháp: cấu trúc to be + going to + V-nguyên thể” – làm (diễn tả hành động chắn xảy tương lai) Chúng ta quan sát câu sau Các b n...

5
631
0

Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot

Ngày tải lên : 18/06/2014, 19:20

... Grabenbauer GG, Amann K, Wehrhan F: Plasminogen activator inhibitor-Irelated regulation of procollagen I (alpha(1) and alpha(2)) by antitransforming growth factor-beta(1) treatment during radiationimpaired ... number per visual field Statistical analysis In order to analyze cytoplasmic immunohistochemical staining and the spatial pattern of expression, the labeling index was determined as the number ... dental/medical thesis dealing with signal transduction of bone regeneration Since no standardized, automated counting of immunohistochemically labeled cells is available yet it was tested that...

11
416
0

báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

Ngày tải lên : 18/06/2014, 19:20

... constitutes a flexible approach to handle stress: information is preferred in situations that are controllable through early intervention By contrast, distraction and avoidance (blunting) are practiced ... neighborhood circles) Interview questions were translated into Portuguese by professional translators and translated back into German by the accompanying translators The interview was identical to ... pertaining to a monitoring and four to a blunting, i.e distracting style of coping Participants are asked to anticipate each scenario and rate how likely they would engage in each of the eight behavioral...

6
435
0

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Ngày tải lên : 18/06/2014, 22:20

... recS-RNA on the passages was monitored by RT-PCR and the isolate appeared to have a stable genotype (data not shown) RecTULV formed foci similar in size to those of the original variant and grew to ... monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor ... V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed our earlier observation [11] that the transfection-mediated...

5
483
0

Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

Ngày tải lên : 20/06/2014, 01:20

... AY582061 PB2 B/ Norway/1/84 AF101984 HA B/ Memphis/5/93 AF129902 NA B/ Memphis/3/93 AF129915 Putative Parents 3SEQ p-value Breakpoint Δ c-AIC B/ Shiga/T30/98 B/ Alaska/03/1992 B/ Guangdong/05/94 B/ Chile/3162/2002 ... shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from ... Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed...

3
282
0