managing the telematics use during drive what does driver wants a cross countries study
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" ppsx
... criteria used (data not shown) Although no statistically significant association between GC exposure and the metabolic syndrome was found, the multivariate analysis did demonstrate a trend in the ... risk factors for the metabolic syndrome as a consequence of inflammation and that the addition of GC use cannot worsen these further Central obesity is associated with increased cardiovascular risk ... substantially to the conception and design of the project and to the revision of the draft of the manuscript All authors read and approved the final manuscript Acknowledgements TET was funded by a...
- 8
- 561
- 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free water, ... test was used for the analysis of matched pairs for protein data as well as for the analysis of mRNA data for the whole group Spearman rank sum test was utilised to statistically compare the degree ... HMGB1 and inhibit its release [34] Oxaliplatin is an antineoplastic platinum-based compound that generates DNA adducts that strongly bind HMGB1 Therefore, gold salts and oxaliplatin share the capacity...
- 8
- 529
- 0
Báo cáo y học: " Association between meniscal tears and the peak external knee adduction moment and foot rotation during level walking in postmenopausal women without knee osteoarthritis: a cross-sectional study" pps
... 0.8 Early stance Any medial meniscal tear y/nb Medial meniscal tear scorec Any lateral meniscal tear y/nb Lateral meniscal tear scorec Late stance Lateral meniscal tear aAdjusted scorec bIncrease ... Clinical Manager's User Manual [20]) Subjects were instructed to walk barefoot at their normal pace over level ground, to capture their natural gait patterns Statistical analysis Gait data were ... structural changes on the causal pathway of biomechanic gait abnormalities and knee disease In addition, it possible that the associations observed are a result of knee injury rather than altered gait;...
- 7
- 375
- 0
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" pptx
... criteria used (data not shown) Although no statistically significant association between GC exposure and the metabolic syndrome was found, the multivariate analysis did demonstrate a trend in the ... risk factors for the metabolic syndrome as a consequence of inflammation and that the addition of GC use cannot worsen these further Central obesity is associated with increased cardiovascular risk ... substantially to the conception and design of the project and to the revision of the draft of the manuscript All authors read and approved the final manuscript Acknowledgements TET was funded by a...
- 8
- 531
- 0
A CROSS-CULTURAL STUDY OF CONCEPTION ABOUT LOVE, MARRIAGE BETWEEN THE VIETNAMESE AND AMERICANS
... the family, the role of a husband and a wife are equal Women not kept their family name but used their husband's family name formally They not pay much attention in fate marriage; they can easy ... request and refusal strategies between the Vietnamese and the American For example, rather than refuse an invitation, a Vietnamese might say yes but then not come Americans, in contrast, use more direct ... engagement - Vietnamese families were patriarchal: the man always took the lead - Divorce was legal but not common in Vietnamese society: a wife was expected to live in an unhappy marriage and...
- 11
- 4,241
- 78
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships, ... say) Working as a nurse A career chart was used to determine whether or not a respondent was working in a nursing post or as an agency or bank nurse at a particular time-point On the chart the ... using the methods described above so respondents from all three branches were amalgamated into one dataset Branch was included as an independent variable in the statistical models and was a significant...
- 12
- 530
- 0
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
... [http://www.biomedcentral.com/content/supplementary/14784491-7-55-S1.doc] Acknowledgements The authors thank our study participants for their support and cooperation We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban ... mortality are responsible for health provider absenteeism and attrition In Zambia, mortality rates are high and before ART was available, death was a common cause of attrition among district health ... Urban District Health Management Team) for their assistance in study implementation and recruitment We thank Moffat Zulu and Martin Daka of CIDRZ for providing data management and data entry assistance...
- 10
- 501
- 0
báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx
... file The VascuQol was used as benchmark and therefore the analyses focusing the association between functional health and the vascular parameters and the mean score differences between patients ... mean age was 68 (± 11) years Table shows the patient characteristics at time of assessment The VascuQol Total score, the VascuQol domains Activity, Symptoms, Pain, Emotional and Social, and the ... revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript 10 11 12 Additional...
- 8
- 386
- 0
báo cáo hóa học: " Clinical implications of gait analysis in the rehabilitation of adult patients with "Prader-Willi" Syndrome: a cross-sectional comparative study ("Prader-Willi" Syndrome vs matched obese patients and healthy subjects)" docx
... Ospedale S Giuseppe" GA was comprised in the clinical assessment that all the ambulant patients have during the hospitalization The Lab was Page of (page number not for citation purposes) Journal ... show any change in sagittal plane knee moment [4] As far as obese adult patients are concerned, obese males display a gait pattern similar to healthy subjects but some of the temporal and angular ... was obtained by the parents and, when applicable, the patients Protocol All the subjects performed a three-dimensional Gait Analysis (GA) assessment at the Movement Analysis Lab of "Istituto...
- 7
- 531
- 0
Báo cáo hóa học: " The relationship between reproductive outcome measures in DDT exposed malaria vector control workers: a cross-sectional study" ppt
... data, analysis and interpretation of data in the study, and in drafting the manuscript and providing important intellectual content JM have participated in the conception, design, analysis and ... Centre-Southern African Programme in Environmental and Occupational Health are acknowledged for their financial support Additionally, the following organisations are thanked for their role in the study: ... Briefly the participants had a high mean age of 43.3 (SD = 9.0 years) The prevalence of abnormal semen (any abnormality) amongst the participants was high (> 45%) Median baseline LH, FSH, SHBG and...
- 7
- 541
- 0
Báo cáo hóa học: " An exploration of job stress and health in the Norwegian police service: a cross sectional study" docx
... conception and design, interpretation of data, drafting of the manuscript and supervision BL was involved in analysis and interpretation of data AMB is the guarantor for this paper Acknowledgements The ... and design, acquisition, analysis and interpretation of data and drafting of the manuscript EH was involved in design, interpretation of data, drafting of the manuscript and supervision ØE was ... normally unarmed and traditionally the level of crime has been low On the other hand, there are several similarities between police populations, such as the male-dominated culture and a reluctance...
- 9
- 443
- 0
báo cáo hóa học:" Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional study" pdf
... slightly agree, 5) somewhat agree, and 6) totally agree Cronbach's alpha for this scale was 85, and the mean score was 3.37 (SD = 1.28) Ethics approval The research data were anonymous as all names and ... strategy in five areas) Each question had five answer categories: 1) not used, 2) used a little, 3) used somewhat, 4) used quite a bit, and 5) used a great deal A principal components factor analysis ... social and family life might ameliorate any potentially negative impact in these areas It is fairly well established that, whether or not actual control is available and can be executed, the...
- 10
- 409
- 0
báo cáo hóa học:" Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study" doc
... of the targeted sample) because some of them were reluctant to participate in the study and because some of them were not available after several visits by the research assistants within the ... the study was explained to the caregivers by trained research assistants before questionnaire administration The caregivers were informed that participation in the study was voluntary, that there ... was assessed by staff in the Nursing and Statistics departments at the University of Botswana, while the staff of the Community Home-Based Care Programme of the Ministry of Health, Botswana, assessed...
- 8
- 384
- 0
báo cáo hóa học:" Assessing the construct validity of the Italian version of the EQ-5D: preliminary results from a cross-sectional study in North Italy" docx
... Dallolio coordinated data entry and data analysis, Dr Savoia provided assistance with data analysis and the narrative of the manuscript All authors revised the text and provided information and ... country Therefore any inference on the Italian population should be cautious The utility value calculated for the EQ-5D was based on the U.K population norm data, debate on the cross adaptability ... each subject's EQ-5D health status by applying the time trade-off-based valuations from a general UK population sample to the observed EQ-5D profile, as data from an Italian norm are not available...
- 9
- 421
- 0
báo cáo hóa học:" The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial diseas" potx
... file The VascuQol was used as benchmark and therefore the analyses focusing the association between functional health and the vascular parameters and the mean score differences between patients ... mean age was 68 (± 11) years Table shows the patient characteristics at time of assessment The VascuQol Total score, the VascuQol domains Activity, Symptoms, Pain, Emotional and Social, and the ... revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript 10 11 12 Additional...
- 8
- 335
- 0
báo cáo hóa học:" Impact of recent life events on the health related quality of life of adolescents and youths: the role of gender and life events typologies in a follow-up study" potx
... GV and JAPV analyzed the data EVO, JMV, MH, MF, LR and JA participated in the drafting of the article All authors contributed to a critical Page of revision of the manuscript and made a substantial ... 5Universitat Autònoma de Barcelona (UAB), Barcelona, Spain Universitat Pompeu Fabra (UPF), Barcelona, Spain Authors’ contributions JMV, LR, and JA participated in the conception and design of the study ... compared to census data[28] A second limitation may arise from the fact that the CLES use an extensive recall period Although it is conceivable that there may operate a recall bias, we tested the...
- 9
- 583
- 0
Báo cáo y học: "Selective serotonin reuptake inhibitor use associates with apathy among depressed elderly: a case-control study" potx
... stay, education, marital status, living status, primary language used, total GDS, total HAMD-21, GAS and HAS at both admission and discharge in SUG and NSUG, an analysis of variance (ANOVA) was ... statistical analysis, and corrected the manuscript TW participated in data management and statistic analysis DC helped with the database collection and statistic analysis All authors read and approved ... discharge Mean total HAM-D 21 at admission Mean total HAM-D 21 at discharge Mean GAS at admission Mean GAS at discharge Mean total GDS at admission Mean total GDS at discharge Co-morbid axis III...
- 6
- 378
- 0
Báo cáo y học: "The prevalence of mental disorders in adults in different level general medical facilities in Kenya: a cross-sectional study" pot
... data and assisted in interpretation of data All the authors have read and approved the final manuscript Acknowledgements This study was conducted with financial assistance from the World Health ... education KNH, Kenyatta National Hospital Table 2: NOK, BDI and LSAD scores across all sites (% of patients) Scores All sites KNH Embu Kiambu Kikuyu Kajiado Kibera Makindu Naivasha Magadi Karuri ... acquisition, analysis and interpretation of data and was involved in drafting the manuscript FAO-O participated in acquisition of data and was involved in drafting the manuscript DAK was involved in acquisition...
- 8
- 701
- 0
Báo cáo khoa học: "Ultrasound-guided central venous catheterization in cancer patients improves the success rate of cannulation and reduces mechanical complications: A prospective observational study of 1,978 consecutive catheterizations" pps
... Statistical analysis Demographic data and clinical features were analyzed using descriptive methods Quantitative variables were summarized using mean and standard deviation Categorical variables ... Commercianti di Agazzano, Comune di Pontenure, Roncarolo, Tramballando, Club Beppe and Dany, Marco Biolchi, Copravolley, Grande Casa Reale e Ducale di Piacenza e Parma, Pro Loco Gazzola, I Fantastici ... lymphoadenopathy, or postradiation therapy area, or at the patient’s request, the CVC was placed on the left side All procedures were performed using standard aseptic techniques and a local anesthesia...
- 7
- 422
- 0
Báo cáo khoa học: "Validation of the new graded prognostic assessment scale for brain metastases: a multicenter prospective study" potx
... of the study; SV, DCW, CM, AM, JJ and PP performed the data capture and analysis SV and DCW drafted the manuscript; DCW and CC performed the statistical analysis; SV and DCW reviewed patient data; ... Chemotherapy; RT, Radiotherapy; IFRT, Involved-field exteranl beam RT; TMZ, temozolomide; CDDP, Cisplatin; TAX, Taxans at the time of diagnosis was available and the exact agreement between the ... et al: Results of whole brain radiotherapy and recursive partitioning analysis in patients with brain metastases from renal cell carcinoma: a retrospective study International journal of radiation...
- 8
- 295
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25