making sense of what you do as a therapist
Making Sense of Animation: How do Children Explore Multimedia Instruction? pot
... purposes of this chapter, animation is defined as “[…] any application which generates a series of frames, so that each frame appears as an alteration of the previous one, and where the sequence of ... animation again because a b It was not clear c You find it pleasant d You find that it explains well e It was too fast Other reason You decided to remain on this step because a You think you understood ... the classroom and some of this deals with visual information that was both animated and accompanied by narration Because of the hypothesized developmental differences between visual and auditory...
- 37
- 548
- 0
báo cáo khoa học: " Making sense of health information technology implementation: A qualitative study protocol" ppsx
... record adoption Information Systems Management 2007, 24:29-42 44 Apker J: Sensemaking of change in the managed care era: A case of hospital-based nurses Journal of Organizational Change Management ... between-case analyses To describe and compare sensemaking across multidisciplinary project teams, data will be analyzed for each case study sub-team so that we can gain a rich understanding of the sensemaking ... sensemaking of each individual team [59] In the cross-case analysis, for this aim, we will organize each team’s sensemaking themes into three separate data matrices and compare across teams to...
- 8
- 438
- 1
Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt
... exact amount of data requested, transferred a packet less than the maximum endpoint size of transferred a zero-length packet IN DATA x ACK STALL NAK OUT DATA x ACK NAK STALL Token Phase Data ... of transaction to follow, data packets contain the payload, handshake packets are used for acknowledging data or reporting errors and start of frame packets indicate the start of a new frame Token ... transaction IN DATA x OUT DATA x Key Token Packet Host Function Data Packet The above diagram shows the format of an Isochronous IN and OUT transaction Isochronous transactions not have a handshaking...
- 30
- 745
- 0
Making sense of a complex world Accounting for royalty arrangements – issues for media companies pptx
... of that team or event Assuming the recognition criteria in IAS 38 Intangible assets are met, an intangible asset will arise because the commercial partner (i.e licensee) has separately purchased ... terrestrial (AM/FM) radio stations, internet radio is able to accurately measure the number of listeners that are currently streaming a webcast For this reason the royalties payable for webcasting are ... the royalty advance asset would probably be “The assessment of an advance is dependent on accurate forecasting of sales” Issue: 4 MIAG 21 22 MIAG Issue: Accounting for royalties payable Recognition...
- 30
- 481
- 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
... Social Studies years years years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives years years years years ... the chance to major in one discipline and minor in another Essentially, that means you are 12 What Can You Do with a Major in Biology? choosing one primary area of study as well as a secondary ... Have you pushed yourself to take an advanced placement (AP) course in biology with the risk of not doing as well as you might have in a regular bio class? Have you demonstrated range, depth, and...
- 142
- 375
- 0
making sense of online learning a guide for beginners and the truly skeptical
... disabled viewers can learn from your instructional materials as easily as anyone else How Do I Stay Sane? bottom line This is a crazy, fast-changing field, and it’s a bit of a struggle to learn and ... program, but chances are that you ll want to use programming in your instructional materials Authoring tools such as Dreamweaver automatically generate JavaScript code as you use the tool At some ... of text Aho recalls the time she wrote what she thought was a great online course, only to have her manager delete at least half the words “I was appalled and offended,” says Aho, “but she was...
- 187
- 415
- 0
I usually catch a bus -Talking About What You Do potx
... Nightclubs? ANNE Not really Occasionally How often you exercise? always How often you watch TV? sometimes STEVE And what you on the weekend? ANNE Sometimes I go shopping How often you go fishing? ... khác: I’m a builder or I build houses ANNE What you do? STEVE I’m a builder I build houses Đôi ta thêm er vào từ để nghề nghiệp: I bake bread I’m a baker I manage a hotel I’m a hotel manager Bạn ... việc bạn: I work in a bank or I work at a bank Vì bạn giáo viên tiếng Anh: What you do? Người trả lời: I work at a school or I work in a school or I teach English or I’m a teacher Bạn nói bạn...
- 9
- 441
- 0
Wiley Inside Information Making Sense of Marketing Data.pdf
... process of `triangulation' If you want to ®nd exactly where you are on a map using a compass you need to ®nd reasonably well-de®ned (natural or manmade) features in the landscape, take compass readings ... grounded in a solid understanding of what academic-based methodological writers are telling us about information management, qualitative and survey research, data analysis and business decision -making ... make sense of incoming marketing information is that data are not always nested in their appropriate context We are all aware of politicians claiming that a comment they have made has `been taken...
- 270
- 1,083
- 1
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively...
- 39
- 1,125
- 3
Making sense of japanese grammar
... that the head noun appears at the end of a noun phrase, a verb at the end of a clause or sentence, and a main clause at the end of a sentence In the above, namae and henji-ga nakatta-desu appear ... sensei-desu Yamada-san-mo sensei-desu “Mr Chiba is a teacher Ms Yamada too (in addition to Mr Chiba) is a teacher.” set of teachers Shinbun-o kaimashita Zasshi-mo kaimashita “I bought a newspaper I also ... repeated across the subordinate and main clause: Iitaku-nai-kara, iwanai “Since I don’t want to say it, I won’t.” Tsukaetara, tsukatte-kudasai “If you can use it, please so.” Neyoo-to shita-kedo,...
- 216
- 475
- 5
Tài liệu What to do after a death in England or Wales pptx
... one later on The registrar may not be able to give you all the copies straight away and may ask you to call back or ask you to pay an amount towards postage so that they can send them to you Registering ... certificate for burial or cremation and a certificate of registration of stillbirth 18 What to after a death You can ask to have a first name for a stillborn baby when you register the death The ... If a baby is stillborn and you want a burial or cremation Certificate for burial or cremation (the white form) 20 What to after a death Arranging the funeral Do not make final funeral arrangements...
- 74
- 342
- 0
Tài liệu IN PLAIN ENGLISH: MAKING SENSE OF THE FEDERAL RESERVE pptx
... Bank of Chicago www.chicagofed.org Federal Reserve Bank of Cleveland www.clevelandfed.org Federal Reserve Bank of Dallas www.dallasfed.org Federal Reserve Bank of Kansas City www.kansascityfed.org ... beauties of the Fed’s decentralized structure Now, back to the tour and on to what we do. ” 10Kansas City Denver Oklahoma City Omaha 11Dallas El Paso Houston San Antonio 12San Francisco Los Angeles ... one-year terms on a rotating basis The chairman of the FOMC is also the chairman of the Board of Governors The FOMC typically meets eight times a year in Washington, D.C At each meeting, a senior official...
- 22
- 531
- 0
Tài liệu The Value of the Case Study as a Research Strategy doc
... are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability is most important during the data collection phase, and involves ... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a ... process of preparation, and has summarized major criticisms An epistemological base for analyzing the value of case study research programmes has been ruled out as a major threat because of inconsistencies...
- 15
- 587
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of...
- 10
- 434
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9...
- 13
- 563
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating...
- 9
- 634
- 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
... between ABC and capability of manufacturing companies + Impacts of the capability on the performance of organizations + Impacts of ABC on the performance of organization It is quite easy to see that ... to access various sources of information nowadays Manual works in manufacturing has a negative relation with the number of machines that are equipped in factories For example, in the past, a car ... of plants are trying to broaden their capacity each year Generally, small companies not have so many capitals as a result; they can not expand their capacity With such kind of this company, adopting...
- 64
- 512
- 0
Making Sense of Transnational Threats pptx
... failure, and strategic warning – in the sense of understanding Al Qaeda and the likelihood of an attack – was good Immediate tactical warning was bad, but it always will be, and trying too hard ... the mark, it’s often ignored, as it was in Somalia in 1993 as the mission of the U.S and UN forces changed In that case, the failing was almost ideological, and the intelligence assessment was ... States A kind of no-man’s land separated the CIA from FBI cases and transcripts, or the FBI from the NSA As a result, there was less attention paid to Al Qaeda in the United States than to Al...
- 67
- 281
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25