making a local drawing whiteboard with
Drawing - Fun With A Pencil
... 1 FUN WITH A PENCIL ALSO BY ANDREW LOOMIS Figure Drawing for All It’s Worth Creative Illustration Drawing the Head and Hands Three-Dimensional Drawing Spacer FUN WITH A PENCIL ANDREW LOOMIS ... can trace a photo, and draw from the tracing, or take any of your own drawings and distort them Here again is a chance for your own invention Draw a square around your subject Divide each way ... Nevertheless, we can take as a basic form a ball sliced off at the sides, leaving it a little wider one way than the other, and adding to it or taking some away The forehead may be flattened, cut...
- 123
- 1,965
- 6
Báo cáo y học: " Experiences of treatment decision making for young people diagnosed with depressive disorders: a qualitative study in primary care and specialist mental health settings BMC Psychiatry " pps
... thank the staff, clients and caregivers from Orygen Youth Health and headspace Barwon, and also Dr Barnaby Nelson and Dr Anita Williams for their assistance with the analysis and methodological ... decision making approaches and analytical stages of decision making, as well as the distinction drawn by Elwyn and Edwards [25] between the decision -making process and who actually makes the final decision ... interview Each interview lasted between 13 and 110 minutes (mean = 43.6 minutes) Page 14 of 47 Data analysis Analysis was undertaken in accordance with Braun and Clarke’s description of thematic analysis...
- 49
- 297
- 0
Báo cáo y học: "Malignant pleural mesothelioma with long-term tumor disappearance of a local relapse after surgery: a case report" doc
... complementary and alternative self-therapy Case presentation A 73-year-old man with a 75-pack-year history of cigarette smoking and asbestos exposure between the ages of 30 and 40 years had been admitted ... as alternative therapy for patients suffering from cancer as well as various other types of disease in Japan [6] In particular, for cancer-bearing patients, it was said that acupuncture therapy ... Several immunological blood parameters such as serum IL-2, INF-alpha, INF-gamma, and CD4/CD8 ratio were examined after the tumor disappearance, but all were within the normal range (data not...
- 4
- 243
- 0
SOME RESULTS ON LOCAL COHOMOLOGY MODULES WITH RESPECT TO A PAIR OF IDEALS
... Divaani-Aazar and A Ma, ”Associated primes of local cohomology modules of weakly Laskerian modules”, Communications in Algebra, 34 (2006) 681-690 [5] A Grothendieck, Cohomologie local des faisceaux ... if and only if L and N are both weakly Laskerian Thus any subquotient of a weakly Laskerian module as well as any finite direct sum of weakly Laskerian modules is weakly Laskerian ii) Let M and ... Yoshizawa, Local cohomology based on a nonclosed support defined by a pair of ideals”, J Pure Appl Algebra, 213 (2009) 582-600 [8] A Tehranian, A Pour Eshmanan Talemi, ”Cofinite of local cohomology...
- 9
- 326
- 0
Cosmological model with a local void and observational constraints
... such as galaxy clusters, filaments, and voids gradually appear The over-density region has stronger gravitational attraction and, accordingly, it causes a larger deceleration of the expansion rate ... showed that the HZS [1, 2] and the SCP data [3] could be fit without a cosmological constant Since then, many years have passed, and more Sne Ia data have now been obtained with higher accuracy Also, ... Tomita’s earlier analyses [35] and examine the variation of the confidence contours as the model parameters vary from their standard values We vary the parameters as follows: Hubble parameters ratio...
- 68
- 100
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis...
- 8
- 499
- 0
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
... for from many different areas (survey, geothermatics, environment, factories) in their websites and make the chart with their agreed result All groups present their ways to and their charts in ... Assessment and correction Marks Having enough partners’ ideas Right as the ideas are led Completing the group’s duty Having the creative combination’s ideas +1 Having plenty of properly illustrated ... habitants’energy consumption for their group’s chart Time on task : three days in maximum In put : words and phrases in coursebook with the structure of relative clause omission ASSESSMENT Assessment...
- 8
- 406
- 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
... et al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in ... SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa et al (1996) reported that enzyme inactivation by the ... method J Agric Food Chem., 44, 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara, K., Muto,...
- 10
- 451
- 1
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... plant shows articulated growth, with a morphological discontinuity at each increment [20] Figure shows Jatropha plant in Energy park of Rajiv Gandhi Proudyogiki Vishwavidyalaya (R.G.P.V.) Jatropha ... Cape Verde was used for soap production and for lamps Jatropha is a small tree or large shrub, which can reach a height of three to five meters, but under favorable conditions it can attain a...
- 12
- 568
- 0
21.5. Making a List
... but they can't see you—great when you're too busy to chat with annoying barely-acquaintances, but want to keep an eye out for a particular pal You can still send and receive messages anyone on ... sorted alphabetically by last name Unavailable buddies (marked by red dots and visible Away messages) get shoved to the bottom By First Name, By Last Name Just what you'd think • Manually This ... Edit Status Menu from the pop-up menu at the top of the iChat buddy list to set up more creative alternatives to "Available" and "Away." Right: Your edited list of status messages is now available...
- 3
- 259
- 0
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study
... cycles, innovation streams, and ambidextrous organisations: organisational renewal through innovation streams and strategic change In Managing Strategic Innovation and Change, Tushman ML, Anderson ... essential part of the organization (Hedlund and Nonaka, 1993) McCartney (1998) states that `the activities that give rise to innovation are basically R McAdam Knowledge and Process Management RESEARCH ... disseminate and embody new knowledge far 236 Knowledge and Process Management beyond the organizational boundaries, leading to increased innovative partnerships and alliances (Nonaka and Takeuchi,...
- 9
- 498
- 2
Dragging a Movie Clip Instance within a Boundary
... evaluate to true because all the conditions are true—347 is greater than 60 and less than 490, and 285 is greater than 220 and less than 390 In this scenario, dragging is allowed Let's look at ... the statement) When the if statement evaluates to true, the startDrag() action is triggered and the basketball_mc instance becomes draggable The true parameter value used in this action causes ... = 490 As shown by the arrows, all coordinates are based on the distance of that side from the top and left sides of the stage TIP An easy and visual method of determining boundary coordinates...
- 7
- 221
- 0
Tài liệu Making a Portfolio pdf
... fancy shoelaces (for the handles) Ü Acid-free cardboard or matt board (usually offered in a wide selection of colors) Acid-free cardboard or matt board is generally available at framing or art ... she was awarded a Certificate of Membership from “Forensic Artists International” Her home-based art career included graphic design, and teaching recreational drawing and painting classes As supervisor ... stores Acid-free refers to a high-quality, long-lasting, and PH-balanced paper or board that has had the acid removed from the pulp in the paper -making process Drawings can be ruined when papers and...
- 6
- 522
- 0
Tài liệu Báo cáo " The total specialization of modules over a local ring" ppt
... a Cohen-Macaulay S -module (ii) LT is a maximal Cohen-Macaulay ST -module if L is a maximal Cohen-Macaulay S -module Proof We need only show that (LT )piT is a (maximal) Cohen-Macaulay (ST )piT ... Lα is also a Cohen-Macaulay Sα -module for almost all α Since Lα = (LT )piT , it follows that LT is a Cohen-Macaulay ST -module for almost all α (ii) Assume that L is a maximal Cohen-Macaulay S ... will define a quasi-Buchsbaum module A finitely generated module over a Noetherian commutative ring is said to be a quasiBuchsbaum module if its localization at every maximal ideal is a surjective...
- 7
- 500
- 1
Tài liệu Doing Business 2011- Making a Difference for Entrepreneurs docx
... Republic Antigua and Barbuda Turkey Montenegro Ghana Belarus Namibia Poland Tonga Panama Mongolia Kuwait St Vincent and the Grenadines Zambia Bahamas, The Vietnam China Italy Jamaica Albania Pakistan ... business became easier 0.2 GEORGIA RWANDA BELARUS BURKINA FASO SAUDI ARABIA MALI KYRGYZ REPUBLIC GHANA CROATIA KAZAKHSTAN MACEDONIA, FYR MOZAMBIQUE EGYPT, ARAB REP UKRAINE CHINA ALBANIA TAJIKISTAN NIGERIA ... Russian Federation Uruguay Costa Rica Mozambique Brazil Tanzania Iran, Islamic Rep Ecuador Honduras Cape Verde Malawi India West Bank and Gaza Algeria Nigeria Lesotho Tajikistan Madagascar Micronesia,...
- 267
- 363
- 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... performed as described previously [9] Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC ... China (grant no 2007AA10Z110) References Okamuro JK, Caster B, Villarroel R, Van Montagu M & Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis...
- 10
- 464
- 1
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25