magic witchcraft and ghosts in the greek and roman worlds a source book

magic witchcraft and ghosts in greek and roman worlds a sourcebook

magic witchcraft and ghosts in greek and roman worlds a sourcebook

Ngày tải lên : 06/07/2014, 15:45
... Magic, Witchcraft, and Ghosts in the Greek and Roman Worlds: A Source Book DANIEL OGDEN OXFORD UNIVERSITY PRESS Magic, Witchcraft, and Ghosts in the Greek and Roman Worlds DANIEL OGDEN ... relating to male and female magical practitioners at a relatively early stage For the relationship between Medea and the Medes see also 66 37 38 MAGIC, WITCHCRAFT, AND GHOSTS IN THE GREEK AND ROMAN ... remove the sheep, burn it in holocaust and then, together with certain elaborate sacrices and spells, they mark off and walk around the place and they listen to the ghosts as they speak and ask the...
  • 360
  • 555
  • 1
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Ngày tải lên : 06/03/2014, 09:22
... 6B) These results indicated that factor Xa cleaved and activated proHP8Xa When activated HP8Xa was mixed with proSpatzle¨ 1A, the 38 kDa pro-Spatzle band disappeared, and a ¨ 12 kDa product was ... ¨ 3¢-RACE and 5¢-RACE to obtain the missing ends of the cDNA, and then used primers encompassing the start and stop codons, with larval fat body cDNA as template, to obtain eight individual clones ... antibody Antibody binding was visualized using alkaline phosphate-conjugated goat anti-rabbit IgG and an alkaline phosphate substrate kit (Bio-Rad) Expression and purification of recombinant proSpatzle-1A...
  • 15
  • 540
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Ngày tải lên : 07/03/2014, 21:20
... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... receptors These are in bold and underlined, and the cysteine knot is boxed The second extracellular domain (C2) also contained 10 cysteines and these are also shown in bold and the cysteine knot ... 2005 FEBS BMP/activin pathway in Crassostrea gigas ted of its highly variable C-terminal domain after the terminal conserved arginine of the cytoplasmic serine ⁄ threonine kinase domain Sequences...
  • 17
  • 508
  • 0
Báo cáo y học: "Efficacy and safety of aripiprazole in the treatment of bipolar disorder: a systematic review" pdf

Báo cáo y học: "Efficacy and safety of aripiprazole in the treatment of bipolar disorder: a systematic review" pdf

Ngày tải lên : 08/08/2014, 23:21
... Annals of General Psychiatry 2009, 8:16 the treatment of acute mania, the approval of quetiapine and the olanzapine-fluoxetine combination against acute bipolar depression and the approval ... Sharma A, Kovalick LJ, Reeves RA: Pharmacokinetics and tolerability of intramuscular, oral and intravenous aripiprazole in healthy subjects and in patients with schizophrenia Clin Pharmacokinet ... comparing aripiprazole to haloperidol and lithium in maintenance and one placebo-controlled adjunctive aripiprazole to lithium or valproate against acute mania (Table 1) Basic facts about aripiprazole...
  • 15
  • 589
  • 0
Báo cáo khoa học: "Helical tomotherapy in the treatment of pediatric malignancies: a preliminary report of feasibility and acute toxicitty" doc

Báo cáo khoa học: "Helical tomotherapy in the treatment of pediatric malignancies: a preliminary report of feasibility and acute toxicitty" doc

Ngày tải lên : 09/08/2014, 09:21
... Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal carcinoma ... http://www.ro-journal.com/content/6/1/102 Page of All patients were examined at least weekly during treatment The acute and subacute toxicity was defined and graded according to the RTOG criteria After the radiation therapy, all the ... manuscript final version All authors read and approved the final manuscript Competing interests Latifa Mesbah, Immacolata Marrone and Sergey Usychkin had financial support from the Grupo IMO Foundation...
  • 9
  • 331
  • 0
báo cáo khoa học: "R-CHOP versus R-CVP in the treatment of follicular lymphoma: a meta-analysis and critical appraisal of current literature" ppt

báo cáo khoa học: "R-CHOP versus R-CVP in the treatment of follicular lymphoma: a meta-analysis and critical appraisal of current literature" ppt

Ngày tải lên : 10/08/2014, 22:20
... of stages and but did not show data from each stage separately Czuczman et al [4] and Marcus et al [7] did not include patients of stage To make the data accurate and comparable across all four ... reassigned patients into two broad stages: early stage (Ann-Arbor stages I and II) and late stage (Ann-Arbor stages III and IV) Combining the studies, there were 439 patients, and over 98% of these ... testing the efficacy of maintenance therapy by rituximab may provide important data in the field of the best induction in patients with follicular lymphoma An unavoidable weakness of any meta-analysis...
  • 7
  • 594
  • 0
báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt

báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt

Ngày tải lên : 11/08/2014, 00:22
... demonstrated a thinly encapsulated neoplasm The diagnosis of a paraganglioma was confirmed by histologic and immunohistologic examinations Because vascular invasion and focal infiltration of the ... retroperitoneal space Paragangliomas arising from carotid bodies appear to have the highest propensity for metastatic spread to the spine [1] The retroperitoneal extra-adrenal paraganglioma is the most aggressive ... obtained The pseudocapsule was examined and considered intact With posterior bisegmental transpedicular screw instrumentation using a rigid internal fixator and anterior strut grafting using a...
  • 6
  • 323
  • 0
Báo cáo khoa học: "Pneumothorax and mortality in the mechanically ventilated SARS patients: a prospective clinical study" ppsx

Báo cáo khoa học: "Pneumothorax and mortality in the mechanically ventilated SARS patients: a prospective clinical study" ppsx

Ngày tải lên : 12/08/2014, 22:22
... hypoxemia in the mechanically ventilated SARS patient A decrease in PaO2/ FiO2 and increase in PaCO2 may be considered as a deterioration of respiratory condition in a patient with ALI/ARDS The presence ... hospitalization Highest PaCO2 ALI/ARDS (%) Liberation from ventilator (%) at 30 days Data are presented as mean ± standard deviation ALI, acute lung injury; APACHE, Acute Physiology and Chronic Health ... in mechanically ventilated SARS patients indicates that the patients with higher respiratory rates on admission, and lower PaO2/FiO2 ratio and higher PaCO2 during hospitalization had a greater...
  • 6
  • 232
  • 0
Báo cáo y học: "Human protein C concentrate in the treatment of purpura fulminans: a retrospective analysis of safety and outcome in 94 pediatric patient" pps

Báo cáo y học: "Human protein C concentrate in the treatment of purpura fulminans: a retrospective analysis of safety and outcome in 94 pediatric patient" pps

Ngày tải lên : 13/08/2014, 21:21
... management, statistical analysis and data interpretation RS was involved in study design, data analysis, and writing of the manuscript All authors read and approved the final manuscript Competing interests ... analysis and interpretation, and writing of the manuscript WK was involved in study design and data analysis BE was involved in study design and data collection UM was involved in data management, ... identified, the principal investigator contacted the treating physician with an invitation to participate in the study If the treating physician agreed to participate, the hospital was visited by a medical...
  • 7
  • 351
  • 0
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Ngày tải lên : 14/08/2014, 17:22
... subjects, as we have already investigated in more detail in the case of the urinary and saliva proteomes In these cases, we found that single and pooled samples were identical in terms of their main ... following additional data are available with the online version of this paper Additional data file lists all peptides and protein hits obtained in both LTQ-FT and LTQ-Orbitrap data Click here data ... by searching the data against the International Protein Index database (IPI_human) by MASCOT (Matrix Science) and MSQuant (an in- house developed, open source software program) These criteria comprised:...
  • 11
  • 289
  • 0
the first world war and the 20th century in the history of gaelic scotland a preliminary analysis

the first world war and the 20th century in the history of gaelic scotland a preliminary analysis

Ngày tải lên : 22/12/2014, 16:55
... Cameron and Iain J.M Robertson, '''Fighting and Bleeding for the Land'': the Scottish Highlands and the Great War' in Catriona M.M MacDonald and E.W McFarland (eds.) Scotland and the Great War ... 'nam bhòtannan, air mo lanaigeadh ann an lannan agus roilean an èisg, coltach ri rud a chuireadh muir a thìr!152 In 'Am Feamnadh' and the passage above, the ideals of crofting - the pastoral and ... sinn Air ar fògradh Alba Far na sgap sinne uile mar bhucas chuileagan dheidheadh fhuasgladh Ach leamsa bu shòlasach a bhith seòladh gu Quebec ann am bàta gun cheanna-bheairt, de gharbh chlachan...
  • 128
  • 417
  • 0
Assessment of weed management practices and problem weeds in the midsouth united states—soybean a consultants perspective

Assessment of weed management practices and problem weeds in the midsouth united states—soybean a consultants perspective

Ngày tải lên : 04/09/2015, 08:07
... hand-weeding fields to remove Palmer amaranth The area where Palmer amaranth was hand-weeded in 2011 was 3.5 and 15% of the total area scouted in Louisiana and the remaining midsouth, respectively (Table ... Tennessee and Arkansas, respectively Barnyardgrass was among the top five problematic weeds in Arkansas, Louisiana, and Tennessee Similar to the problem ranking, Palmer amaranth, morningglories, barnyardgrass, ... On average, hand-weeding added an additional US$46 and US$59 haÀ1 to soybean-production input costs in Louisiana and the remaining midsouth, respectively Palmer amaranth hand-weeding costs as...
  • 12
  • 556
  • 0
Inflation And Economic Growth Nexus In The  Southern African Development Community: A Panel Data Investigation

Inflation And Economic Growth Nexus In The Southern African Development Community: A Panel Data Investigation

Ngày tải lên : 12/12/2016, 20:39
... HISTORY AND OBJECTIVES OF SADC In 1980, nine Southern African countries, namely; Angola, Botswana, Lesotho, Malawi, Mozambique, Swaziland, Tanzania, Zambia and Zimbabwe formed the Southern African ... South Africa (SA), Swaziland, Tanzania, Zambia and Zimbabwe, and its headquarters are in Gaborone, Botswana The member countries have differing levels of education, health provisions and other socio-economic ... that averaging over several years may obscure useful information in the data, so that studies using annual data are preferable Bittencourt (2012) used an annual data set for four Latin American...
  • 92
  • 387
  • 0
Greek and roman mythology a to z

Greek and roman mythology a to z

Ngày tải lên : 29/03/2016, 22:26
... M PA Taranto NI Naples CALABRIA A Pompeii LUCANIA Tarquinia Sardinia Tyrrhenian Sea BRUTII Messina Ionian Sea Reg Reggio di Calabria Medit erra nea n S ea N Sicily Siracusa Carthage © Infobase ... writers from the classical period say that Astraea was the daughter of the Titans Astraeus and Eos Astraeus  (Starry)  Greek A second-generation Titan god and father of the winds and the stars His ... Arcas  (Arctos; Bear)  Greek Son of Callisto and Zeus, married to the Dryad Erato, father of many Arcas was king of Arcadia, an isolated, mountainous area in the Peloponnesus peninsula He had...
  • 177
  • 619
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Ngày tải lên : 14/02/2014, 14:20
... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Ngày tải lên : 21/02/2014, 03:20
... sidechain of Lys (API) or Lys and Arg (trypsin) The aromatic stacking between Trp169 and His210 in API is unique among chymotrypsintype serine proteases MATERIALS AND METHODS Materials The substrate ... side-chain of His210 increased with the decrease in size of the side-chain at residue 169 (Table and Fig 3A) However, the ASAs of Asp113 and His57 remained constant when the side-chain at residue ... side-chain of His210 On the other hand, a small side-chain at position 169, typically W169V and W16 9A, deviates from the original position In the structural deviation, the solvent ASA of the side-chain...
  • 7
  • 603
  • 0
Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx

Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx

Ngày tải lên : 21/02/2014, 11:20
... resource accounting and budgeting In Australia the main driver for change was the introduction of Accruals-based Outcome and Output Budgeting In Canada, the Office of the Auditor General and the ... staff and mangers to the tasks at hand Monitoring (collecting) performance data: Once indicators and targets are set, actual data for each indicator is collected at regular intervals Implementation ... performance, etc Typically performance data and/ or ratings are presented in standard, comparable formats that can be easily entered into databases and summarized across the portfolio They are meant...
  • 158
  • 572
  • 0
Estrogen in the adult male reproductive tract: A review ppt

Estrogen in the adult male reproductive tract: A review ppt

Ngày tải lên : 05/03/2014, 17:20
... sections and the ER21 antibody, which is made against a peptide containing the first 21 amino acids of the rat and human ERα (does not cross-react with ERβ), we also found predominant staining in efferent ... reabsorption This inhibition is mediated by a decrease in the expression of NHE3 mRNA and protein and also decreases in carbonic anhydrase II (CAII) and aquaporin I (AQP-1) proteins There is also ... Takeyama J, Suzuki T, Inoue S, Kaneko C, Nagura H, Harada N and Sasano H: Expression and Cellular Localization of Estrogen Receptors alpha and beta in the Human Fetus J Clin Endocrinol Metab 2001,...
  • 14
  • 370
  • 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

Ngày tải lên : 07/03/2014, 15:20
... constants corresponding to apparent rate constants are obtained by fitting Eqn (1): DAbs ¼ a þ b eÀct ð1Þ where, DAbs is the variation of absorbance, a and b are amplitude parameters and c is the ... for each experiment Apart from these artifacts the distributions of the residuals show a good agreement between experimental data and the plot obtained by fitting The traces obtained are comparable ... containing a low-potential and a high-potential [Fe-S] Thus each structural domain of b may be a transfer unit for the electron transfer pathway in this enzyme In our scheme we have integrated these...
  • 8
  • 442
  • 0
The Project Gutenberg EBook of A First Book in Algebra, pot

The Project Gutenberg EBook of A First Book in Algebra, pot

Ngày tải lên : 15/03/2014, 00:20
... marbles, and finds that he then has 93 marbles How many had he at first? In three pastures there are 42 cows In the second there are twice as many as in the first, and in the third there are one-half as ... − 4a, − 3a, − 2a, a, −0, a, 2a, 3a, 4a, 5a What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must ... What then must be subtracted from − 4a to obtain a? (− 4a) − (− 3a) =? Examine now these results expressed in another form 33 From take 5a 3a 2a To add 5a − 3a 2a From take 4a 7a − 3a To add 4a −7a...
  • 189
  • 432
  • 0