0

lu zi guo yuan xiao li zhang ru yan ya qin zhao ming liao 2012 saikosaponin a and its epimer saikosaponin d exhibit anti inflammatory activity by suppressing activation of nf κb signaling pathway international immunopharmacology 14 1 pp 121 126

Tổng quan về tác dụng của 20 vị thuốc giải biểu và thuốc phát tán phong thấp

Tổng quan về tác dụng của 20 vị thuốc giải biểu và thuốc phát tán phong thấp

Y khoa - Dược

... anhydrobyakangelicin, senbyakangelicin, xanthotoxin neobyakangelicin [279] Từ rễ A dahurica có 26 coumarin glycoside phân lập: sec.-Obeta -D- Galactopyranosyl-(R)-byakangelicin, (R)-peucedanol-7-O-beta -D- ... cutaneous anaphylaxis test PGE2 Prostaglandin E2 PPARα Peroxisome proliferator-activated receptor alpha PPARγ Peroxisome proliferator-activated receptor gamma TNF-α Tumor necrosis factor alpha ... dihydrochloride ABTS 2,2'-azino-bis(3-ethyl benzothiazoline-6-sulphonic acid) ALP Alkaline phosphatase AMPK 5′-AMP-activated protein kinase CCl Cacbon tetraclorua CIA Collagen-induced arthritis COX -1 Cyclooxygenase-1...
  • 132
  • 1,921
  • 3
Báo cáo y học:

Báo cáo y học: "Toxic effects of methoxychlor on the episodic prolactin secretory pattern: Possible mediated effects of nitric oxide production" pdf

Báo cáo khoa học

... rats treated with the pesticide reduced mean plasma prolactin levels and the absolute amplitude of prolactin peaks (Table 1) Peak duration, relative amplitude and frequency of prolactin peaks were ... animals AL and AIE supervised the study and drafted the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by grants from the University of ... designed the experiments AL and PC carried out the radioimmunoassay for prolactin and the analysis of dopamine by HPLC AL and TC performed the statistical analysis TC took care of the experimental animals...
  • 9
  • 528
  • 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Báo cáo khoa học

... vivo degradation of NOS and HSP90 by calpain M Averna et al Table Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for weeks The data reported ... electroblotting, and immunoblotting analysis was performed as described above The immunoreactive material was detected and quantified as described above Assay of NOS activity NOS activity was assayed by detecting ... Experimental hypertension was induced in 60-day-old rats by feeding ad libitum with a standard rat chow and providing NaCl dissolved in tap water at a concentration of 10 gÆL )1 for a period of time ranging...
  • 11
  • 344
  • 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Báo cáo khoa học

... on DNA gyrase Results Antimicrobial effects of HNr and related peptides and nonpeptides H4-(86 10 0) and HNr (Fig 1) were tested for their bactericidal activity against Gram-negative and Grampositive ... antimicrobial potency of HNb could be improved by amidation of its C-terminal amino acid (LD50: 10 .6 lgÆmL )1) or addition of Gly-amide (LD50: 15 .3 lgÆmL )1) HN-like cyclic tetrapeptides and nonpeptides ... the radial diffusion assay Samples were applied to paper disks and placed onto an agarose plate inoculated with bacteria as described in Experimental procedures After overnight incubation at 37...
  • 12
  • 756
  • 0
RESPIRATORY HEALTH EFFECTS OF PASSIVE SMOKING: LUNG CANCER AND OTHER DISORDERS ppt

RESPIRATORY HEALTH EFFECTS OF PASSIVE SMOKING: LUNG CANCER AND OTHER DISORDERS ppt

Sức khỏe giới tính

... of Title IV of Superfund (The Radon Gas and Indoor Air Quality Research Act of 19 86) to provide information and guidance on the potential hazards of indoor air pollutants Two drafts of this report ... 19 90, and was subsequently reviewed by the EPA Science Advisory Board (SAB) on December and 5, 19 90 The SAB Review Draft incorporated many of the public comments and especially the valuable advice ... Division, Office of Atmospheric and Indoor Air Programs, Office of Air and Radiation, which defined the assessment's scope and provided funding The report has been developed under the authority of Title...
  • 20
  • 377
  • 0
Effects of white rice, brown rice and germinated brown rice

Effects of white rice, brown rice and germinated brown rice

Sinh học

... GTACGACTCACTATAGGGACCATTCGCATTAACCAGCTT GTACGACTCACTATAGGGAGGGCTTCACTTCTTGCAAAC AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA AGGTGACACTATAGAATACACACGGCTCACATTGCAT GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC ... EEF 1A1 [NM_0 014 0 2] a Kanr b * Primer sequences * (with universal tag) Forward Reverse AGGTGACACTATAGAATAGCTCAGCTGACACAGTTCGT AGGTGACACTATAGAATACAAGCGTGACTTTGGGTCTT GTACGACTCACTATAGGGACCATTCGCATTAACCAGCTT ... reported by Rozan et al [ 31] TPC was determined as detailed by Meda et al [32], while antioxidant assays (DPPH and ABTS) were determined as reported by Kim et al [33] TPC of BR and WR ethanolic extracts...
  • 18
  • 389
  • 2
Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Vật lý

... strong localization of HOMO and LUMO Fig 10 Calculated energy levels at the G point for the Si145BPH100-nc, the Si144BBPH100-nc, the Si144BPPH100-nc and the Si143BBPPH100-nc Alignment has been ... impurity in order to obtain either the Si144BBPH100 (with an excess of B: B atoms and P) or the Si144BPPH100-nc (with an excess of P: B and P) and finally, adding simultaneously two B and two P atoms, ... 1. 15 3.35 2.20 1. 15 D is the calculated Stokes shift between absorption and emission energy gaps Fig Formation energies for single, codoped and multidoped Si147H100 based nanocrystals an odd...
  • 8
  • 1,024
  • 0
effects of flower - like, sheet - like and granular sno2 nanostructures

effects of flower - like, sheet - like and granular sno2 nanostructures

Vật lý

... causes to reduce the overall reaction rate and broaden the distribution of product NaBr, NaCl, and NaF as salt-assisted additives are expected to cause cage-like shells surrounding the SnO particles, ... alumina tube with gold electrodes already deposited on it The sample was dried and calcined at 400 ◦ C Thus obtained sensor was placed in a glass holder immersed in a molten salt bath, temperature ... Pourfayaz, A Khodadadi, Y Mortazavi, S.S Mohajerzadeh, Sens Actuators B: Chem 10 8 (2005) 17 2 [6] G.X Wang, J.S Park, M.S Park, X.L Goua, Sens Actuators B: Chem 13 1 (2008) 313 [7] N Amin, T Isaka,...
  • 4
  • 325
  • 0
The Health Effects of Air Pollution: Separating Science and Propaganda pptx

The Health Effects of Air Pollution: Separating Science and Propaganda pptx

Điện - Điện tử

... population) Notes: Ozone exceedance days are based on the 8-hour ozone standard Sources: Ozone data were downloaded from EPA at www.epa.gov/ttn/airs/airsaqs/detaildata/downloadaqsdata.htm Asthma ... downloaded from EPA at http://www.epa.gov/ttn/airs/airsaqs/detaildata/downloadaqsdata.htm study—the one that found that higher air pollution was associated with a lower risk of developing asthma And ... Services Air pollution data were extracted from the California Air Resources Board’s 2003 Air Pollution Data CD The latest edition of this CD is available at http://www.arb.ca.gov/aqd/aqdcd/aqdcd.htm...
  • 22
  • 478
  • 0
Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

Báo cáo khoa học

... included soups and salads, burgers and sandwiches, pasta, vegetarian items, and prime and choice steaks Additionally, diners had the option of a daily special, usually a ‘surf -and- turf’ combination ... Ellison, Lusk, and Davis [11 ]) In the larger data set, we utilized the same three menu treatments and Ellison et al International Journal of Behavioral Nutrition and Physical Activity 2 013 , 10 : 21 ... for analyzing the data and writing the paper, with all of the authors contributing by reviewing and editing drafts of the manuscript All authors read and approved the final manuscript Page of...
  • 9
  • 420
  • 0
báo cáo hóa học:

báo cáo hóa học:" The effects of stochastic resonance electrical stimulation and neoprene sleeve on knee proprioception" doc

Hóa học - Dầu khí

... have stabilized and this was set as the point where the standard deviation changed by less than percent of the cumulative mean The progression of the means and standard deviations were calculated ... measuring the progression of means and standard deviations as the trial number increased [23] Their goal was to determine the point at which the mean and standard deviation could be considered ... critically revised the manuscript PW conceived and designed the study and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements Financial support was...
  • 9
  • 506
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc

Hóa học - Dầu khí

... activity Gus activity CI 110 -1 CI 110 -2 CI 111 -1 CI 111 -2 CI 112 -1 CI 112 -2 CI 113 -1 CI 113 -2 CI 11 4- 1 CI 11 4- 2 CI 115 -1 CI 116 -1 CI 116 -2 CI1 21- 1 CI1 21- 2 CI129 -1 CI129-2 CI138 -1 CI138-2 Tai A4 05 nm 80 60,4 38,5 ... (Pierce) DAS ELISA assays The virus concentration was evaluated by DAS-ELISA as described previously [32] DAS-ELISA was performed with diluted (1/ 1000 v/v) polyclonal antiserum against an isolate ... were; CI 110 , 11 1, 11 2, 11 3, 11 4, 11 5, 11 6, 12 1, 12 9, and 13 8 [27] (Figure 2) They were independently propagated in the susceptible cultivar O sativa spp indica cv IR64 CI17 Ser2/3 CI 116 CI 115 CI63...
  • 12
  • 384
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Immunostimulatory effects of anionic alkali mineral complex solution Barodon in porcine lymphocytes " potx

Báo cáo khoa học

... minerals including Si, Ag and Na, K ions as an alkali (pH 13 .5) solution Although Barodon was patented in US as an anionic solution and also registered in Korea, the exact mechanism of Barodon and ... of analysis were used as in dual staining of Fig 16 and 17 Barodon-fed (Tx -1 and Tx-2) pigs had more CD4+CD8+ dpp in mesenteric lymph nodes than Barodon-nonfed pigs Compared to Tx -1 and Tx-2 exhibited ... to measure leukocyte subpopulations and Fig Experimental design Control : Barodon-Nonfed Tx -1 : Barodon 0.05% spray feed Tx-2 : Barodon-additive 3% added feed : Barodon added feed supplementation...
  • 10
  • 346
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "The effects of elevated CO 2 and water stress on whole plant CO 2 exchange, carbon allocation and osmoregulation in oak seedlings" docx

Báo cáo khoa học

... Fagus grandifolia and Acer saccharum in low irradiance Oecologia 98, 31- 39 Retuerto R, Woodward FI (19 93) The influences of increased CO and water supply on growth, biomass allocation and water ... leaf mass ratio (SLA, dm g and leaf area ratio (LAR, dm -1 ) ) -1 g were calculated as the leaf area to leaf mass and the leaf area to plant mass, respectively partments partitioning was Carbon ... given date during the drying cycle, a transpiration index — considered as a measure of internal plant drought constraint—was calculated at the individual plant level as the ratio actual...
  • 13
  • 284
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Long-term effects of culture establishment from shoot-tip explants in micropropagating oak (Quercus robur L)" pdf

Báo cáo khoa học

... option as demonstrated by numerous examples of recovering virus-free plants (Morel and Martin, 19 52; Wang and Hu, 19 80), fungi-free plants (Baker and Phillips, 19 62), and bacteria-free plants (Knauss, ... vitamin solution (Murashige and Skoog, -1 1962) complemented with 10 mg•l glutamine and 10 mg•l asparagine; -1 buds - - - 30 agar Shoots derived from nodal explants and from cloned into ... Blaselle A (19 85) Essais de rajeunissement de l’Epic a par les cytokinines Ann AFOCEL 19 84, 17 3 -18 6 Chalupa V (19 84 ) In vitro propagation of oak (Quercus robur L) and linden (Tilia cordata Mill)...
  • 8
  • 240
  • 0
Báo cáo y học:

Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx

Báo cáo khoa học

... ON, Canada), de-paraffinized in toluene, rehydrated in a reverse graded series of ethanol and pre-incubated with 0.25 units/ml chondroitinase ABC (Sigma-Aldrich Canada, Oakville, ON, Canada) in ... contributions JPP, JM-P, PM, GBG and CB participated in the study design CB, JC and JPP participated in the acquisition of data CB, JMP, JC and JPP participated in the analysis and interpretation of data ... the catabolism of OA cartilage For instance, MMP -13 has been demonstrated to play a predominant role in the degradation of collagen type II in OA cartilage [23], whereas ADAMTS4 and ADAMTS5 are...
  • 9
  • 547
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Pharmacokinetics and Pharmacodynamic Effects of Flunixin after Intravenous, Intramuscular and Oral Administration to Dairy Goats" pptx

Báo cáo khoa học

... mL of goat plasma was used and the internal standard (200 µl) was added to the plasma and mixed Then flunixin and diclofenac were extracted by an addition of mL of diethyl ether After gentle mixture ... pp .1- 27 Kluwer Academic Publishers and William Harvey Press, London 19 96 Wasfi IA, Boni NS, Abdel Hadi AA Elghazali M, 15 9 Zorob O, Alkatheeri NA, Barezaiq IM: Pharamcokinetics, metabolism and ... were included Lambda was also used to extrapolate AUC and the AUMC to infinity (inf) From AUC and AUMC, clearance (CL), mean residence time (MRT) and volume of distribution at steady state (Vdss)...
  • 7
  • 381
  • 0
Báo cáo y học:

Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc

Báo cáo khoa học

... Glutathione: an overview of biosynthesis and modulation Chem Biol Interact Chem Biol Interact 19 98 Apr 24 ;11 111 2 :1 -14 19 98, 11 1 -11 2 :1 -14 Zhao M, Rudek MA, Mnasakanyan A, Hartke C, Pili R, Baker ... Acknowledgements Additional file Structures and HDAC inhibiting activity of the cited HDACIs Where data on human HDACs are unavailable, data on maize HD1-B (homologous with human class I HDACs) and HD1 -A (homologous ... study, supervised their synthesis and participated in manuscript drafting SN and SED conducted the biological testing and contributed to molecular modeling and data analysis SV, DR, and LA conducted...
  • 10
  • 418
  • 0
Báo cáo y học:

Báo cáo y học: "Effects of thoraco-pelvic supports during prone position in patients with acute lung injury/acute respiratory distress syndrome: a physiological study" potx

Báo cáo khoa học

... Intra-abdominal pressure was estimated by measuring the bladder pressure by the method of Cheatham and Safcsak [ 21] Statistical analysis Data are shown as means ± SD All data were analyzed with ... and hemodynamics All variables were recorded at the end of each study period Blood gas tensions in the arterial and central venous blood were analysed with a blood gas analyzer (IL -13 12 Blood ... exchange, and hemodynamics Materials and methods Study population Eleven consecutive intubated patients with ALI/ARDS, defined in accordance with standard criteria [17 ], were included in the study None...
  • 9
  • 357
  • 0

Xem thêm

Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25